ID: 1049391518

View in Genome Browser
Species Human (GRCh38)
Location 8:142373948-142373970
Sequence CACTGTGTGTGTGGAGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049391514_1049391518 -4 Left 1049391514 8:142373929-142373951 CCTCAGGCTCCAGGTAATACACT 0: 1
1: 0
2: 2
3: 11
4: 136
Right 1049391518 8:142373948-142373970 CACTGTGTGTGTGGAGCAAAGGG No data
1049391510_1049391518 29 Left 1049391510 8:142373896-142373918 CCCAGGGGATTAAAACATCAACA 0: 1
1: 0
2: 1
3: 19
4: 233
Right 1049391518 8:142373948-142373970 CACTGTGTGTGTGGAGCAAAGGG No data
1049391511_1049391518 28 Left 1049391511 8:142373897-142373919 CCAGGGGATTAAAACATCAACAA 0: 1
1: 0
2: 1
3: 29
4: 243
Right 1049391518 8:142373948-142373970 CACTGTGTGTGTGGAGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049391518 Original CRISPR CACTGTGTGTGTGGAGCAAA GGG Intronic
No off target data available for this crispr