ID: 1049391831

View in Genome Browser
Species Human (GRCh38)
Location 8:142375564-142375586
Sequence TGCACCGAAGGCTGCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049391831 Original CRISPR TGCACCGAAGGCTGCCCAGT GGG (reversed) Intronic
915003437 1:152614372-152614394 TCCACAGAAGGCTGCTCAGTGGG + Intergenic
915349059 1:155213284-155213306 TGCAGGCAAAGCTGCCCAGTGGG + Exonic
915352246 1:155233911-155233933 TGCAGGCAAAGCTGCCCAGTGGG + Intergenic
920836649 1:209517273-209517295 TGCTCCCAAGGATGCCCAGCGGG + Intergenic
924034619 1:239923747-239923769 AGCACGTATGGCTGCCCAGTTGG + Intergenic
1069606577 10:69742598-69742620 TCTACAGAAGGCTGCCCTGTAGG + Intergenic
1070335666 10:75453167-75453189 TTCACAGAAGGATGCCCTGTTGG - Intronic
1076668732 10:132107430-132107452 TGCCCCGCAGGGTGCCCAGCGGG - Intronic
1076939204 10:133590486-133590508 TGCACTGGGGGCTGCCCAGAGGG + Intergenic
1079331205 11:19534327-19534349 TGCACTGAAGTCTGCACTGTGGG - Intronic
1080836587 11:35945354-35945376 AGCAGGAAAGGCTGCCCAGTGGG - Intronic
1081783921 11:45733102-45733124 TGCACCGAAGGCAGCCAGGTGGG + Intergenic
1081802820 11:45871448-45871470 TGCACTGAAGGATGGTCAGTAGG + Intronic
1081899956 11:46619223-46619245 TGCAAAGGAGGCTGCCCAGAGGG + Intronic
1083854344 11:65385256-65385278 TGCAGGGAAGGGTGTCCAGTGGG - Intergenic
1084599391 11:70135967-70135989 GGCACCCATGCCTGCCCAGTAGG - Intronic
1085447407 11:76610060-76610082 TGCACGGGAGGCTGCCCTGCTGG + Intergenic
1096215744 12:49796675-49796697 AGCACCGAAGCCTGGCCTGTGGG + Exonic
1096968458 12:55647169-55647191 TGCTGCGAGGGCTGCCCAGGAGG - Intergenic
1105279036 13:18952614-18952636 TCCCCCCAAGGCTGCCCACTGGG - Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1113436856 13:110299194-110299216 TGCACCTAAGGCTGCTCAAGCGG + Intronic
1116030694 14:39567877-39567899 TTCCCCAAAGGCTGCCCAGGGGG - Intergenic
1121877495 14:97466951-97466973 TGCACAGAAGGGTGCCCCCTTGG + Intergenic
1122234023 14:100322123-100322145 TGTCCCGAGGGCTGCCCAGATGG + Intergenic
1124591488 15:31057657-31057679 TGCAGCAAAGGCTACCCTGTGGG - Intronic
1126070162 15:44859033-44859055 TGCACCTGAGGCAGCACAGTGGG + Intergenic
1126087874 15:45026060-45026082 TGCACCTGAGGCAGCACAGTGGG - Intronic
1126143817 15:45458198-45458220 TGCACTGCAGCCTGCCAAGTTGG + Intergenic
1127053045 15:55104849-55104871 TGCAACTATAGCTGCCCAGTGGG + Intergenic
1131629847 15:94165133-94165155 TGCACAGAAGGCTGCTAAGATGG - Intergenic
1132918762 16:2370948-2370970 TGCCCTGAAGGCTGACCTGTAGG + Intergenic
1141610091 16:85176403-85176425 TGCAGCCAAGGCAGCCAAGTGGG - Intronic
1142194460 16:88733062-88733084 TGCACACAAGGGTGTCCAGTAGG - Intronic
1142431261 16:90029137-90029159 TGCCCCGTAGGCTGCCCCGTAGG - Exonic
1142431266 16:90029149-90029171 TGCCCCGTAGCCTGCCCCGTAGG - Exonic
1142431281 16:90029197-90029219 TGCCCCGTAGCCTGCCCCGTAGG - Exonic
1142490329 17:274379-274401 TGCCAGGAAGGCTGCCCAGGCGG - Intronic
1144425405 17:15136653-15136675 TCCACCGAAGTCTGTCTAGTAGG - Intergenic
1149450863 17:56748964-56748986 TGCACAGATGGGTCCCCAGTCGG + Intergenic
1154126078 18:11693672-11693694 TGCACCGAAAGCTGGGCATTGGG + Intronic
1157716590 18:49892018-49892040 TGCTCTGAAGGCTGCTCAATGGG - Intronic
1159607785 18:70493602-70493624 TGCACCGTAGGCTCCGCAGCAGG - Intergenic
1163441364 19:17324027-17324049 TGCACCGGAAGCCGCCCAGGGGG - Intronic
1164553893 19:29234940-29234962 TGCACCTGAGGCAGCCCAGTTGG + Intergenic
926222674 2:10946506-10946528 TGTGAGGAAGGCTGCCCAGTTGG - Intergenic
933966933 2:87437694-87437716 AACACCCAGGGCTGCCCAGTGGG + Intergenic
934538760 2:95158358-95158380 TGCACTGAAGGATGAACAGTCGG + Intronic
936326863 2:111512803-111512825 AACACCCAGGGCTGCCCAGTGGG - Intergenic
938790971 2:134675719-134675741 TTCACTGGAGGCTGCCCTGTTGG - Intronic
947348908 2:229222034-229222056 AGCACTGAAGGCTTCCGAGTGGG - Intronic
1170455297 20:16527304-16527326 TGATCCAGAGGCTGCCCAGTTGG + Intronic
1172596195 20:36152882-36152904 TGTACAGAAGGCTGCCAAGCAGG + Intronic
1173681599 20:44885953-44885975 TGCGACGACGGCGGCCCAGTGGG + Intronic
1175604329 20:60299759-60299781 TGCTCCCCAGGCTGCCCACTGGG - Intergenic
1175960952 20:62636150-62636172 TGCCCTGAAGGCTGCCGAGGCGG + Intergenic
1176090182 20:63315146-63315168 TGCCCCCAAGACAGCCCAGTGGG - Intronic
1177677317 21:24317346-24317368 TGCAGAGCAGGCTGCCCCGTAGG + Intergenic
1180120702 21:45745676-45745698 TGAGCCCAAGGCTGCCCAGCGGG - Intronic
1182500606 22:30743983-30744005 TGCCCAGAAGGCTGCCCTCTTGG - Intronic
1183276263 22:36900147-36900169 TGCACTGTAGGCTGCCCCATGGG + Intergenic
1185085111 22:48736731-48736753 GTCACCGAAGTCTGCCCTGTTGG + Intronic
1185372896 22:50469143-50469165 ACCACCGAAGGATGCCCAGATGG + Intronic
953390498 3:42531128-42531150 TGCACCTAGGGCTGACCTGTGGG + Intronic
961427455 3:126859211-126859233 TGCCCAGAAGGCTTCTCAGTGGG + Intronic
968609088 4:1549043-1549065 TGCACTGCAGGCAGCCCAGAGGG + Intergenic
968725599 4:2246474-2246496 TGCACTGGAGGTGGCCCAGTGGG - Intergenic
969115661 4:4869274-4869296 TGCAACAAAGGCTGCCACGTAGG - Intergenic
969870430 4:10101193-10101215 TGCACTGAGGACTGCCCCGTGGG + Intronic
972561493 4:40232730-40232752 TGCACTGTGGGCTGCTCAGTGGG - Intronic
975934514 4:79562189-79562211 TAGACTGAAGGCTGCACAGTTGG + Intergenic
976835265 4:89365013-89365035 AGCAGCGATGGCTGCCCTGTGGG + Intergenic
985137186 4:186798187-186798209 TGAACCCAAGTCTTCCCAGTTGG - Intergenic
985528594 5:420707-420729 TGCATGGAAGGCGGCCCAGAAGG + Intronic
990003799 5:50922802-50922824 TGCACTGCAGGCAGCCCAGAGGG - Intergenic
1001164143 5:169348206-169348228 GGCACCCAGGGCTGCCCAGTGGG - Intergenic
1001339743 5:170832267-170832289 TGCACCACAGGATGCCCAGTTGG - Intergenic
1002371343 5:178757482-178757504 TGCACCACAGGATGCCCAGCTGG + Intergenic
1011482398 6:87808275-87808297 GTCATTGAAGGCTGCCCAGTAGG - Intergenic
1016392278 6:143586574-143586596 TGCAGAGCAGGCTACCCAGTAGG + Intronic
1018392565 6:163351573-163351595 GGCTGAGAAGGCTGCCCAGTAGG + Intergenic
1018425601 6:163677576-163677598 TAGACTGAAGGCTGCCCTGTTGG + Intergenic
1024963700 7:55004065-55004087 AGGACCGAAGGCTGCTCAGGGGG - Intergenic
1026134477 7:67647272-67647294 TGGACTGAAGGCTGCACGGTCGG - Intergenic
1026778640 7:73248451-73248473 TGCATCGAAGGCTGCATACTTGG + Intergenic
1027019500 7:74801859-74801881 TGCATCGAAGGCTGCATACTTGG + Intronic
1027068526 7:75144082-75144104 TGCATCGAAGGCTGCATACTTGG - Intronic
1031144121 7:117979006-117979028 CAGACCGAAGGCTGCACAGTTGG - Intergenic
1033249559 7:139747102-139747124 TGCACCAAATACTGCCCAGTTGG + Intronic
1034053999 7:148015389-148015411 TGCAGTGAAGGCCGCACAGTGGG + Intronic
1035899406 8:3441949-3441971 TGCCCCGAAGACTTTCCAGTGGG + Intronic
1047233240 8:123015564-123015586 GGTACCGCTGGCTGCCCAGTAGG - Exonic
1049391831 8:142375564-142375586 TGCACCGAAGGCTGCCCAGTGGG - Intronic
1055734574 9:79313228-79313250 TGCTCAGCAGGCAGCCCAGTGGG + Intergenic
1193082650 X:77421323-77421345 TGCATGACAGGCTGCCCAGTGGG + Intergenic
1193121091 X:77823654-77823676 CACACCGAAGGCTGCACTGTTGG + Intergenic
1196191829 X:112802850-112802872 TTCAGCGAGGGCTGCCCAGTGGG + Intronic
1196344015 X:114630833-114630855 TGCACCGCTTGATGCCCAGTTGG - Intronic