ID: 1049392193

View in Genome Browser
Species Human (GRCh38)
Location 8:142377627-142377649
Sequence GGTTAGTGCTGGTGCATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049392189_1049392193 -7 Left 1049392189 8:142377611-142377633 CCAGCACCTGCCATCGGGTTAGT 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1049392193 8:142377627-142377649 GGTTAGTGCTGGTGCATAACTGG No data
1049392185_1049392193 7 Left 1049392185 8:142377597-142377619 CCAGCCAGAGGATGCCAGCACCT 0: 1
1: 0
2: 2
3: 21
4: 223
Right 1049392193 8:142377627-142377649 GGTTAGTGCTGGTGCATAACTGG No data
1049392184_1049392193 8 Left 1049392184 8:142377596-142377618 CCCAGCCAGAGGATGCCAGCACC 0: 1
1: 0
2: 3
3: 23
4: 200
Right 1049392193 8:142377627-142377649 GGTTAGTGCTGGTGCATAACTGG No data
1049392186_1049392193 3 Left 1049392186 8:142377601-142377623 CCAGAGGATGCCAGCACCTGCCA 0: 1
1: 0
2: 5
3: 32
4: 299
Right 1049392193 8:142377627-142377649 GGTTAGTGCTGGTGCATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049392193 Original CRISPR GGTTAGTGCTGGTGCATAAC TGG Intronic
No off target data available for this crispr