ID: 1049393054

View in Genome Browser
Species Human (GRCh38)
Location 8:142381871-142381893
Sequence GCCGCAGCTCATCCTGCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049393045_1049393054 19 Left 1049393045 8:142381829-142381851 CCCTGCCTGCCTTGGCATTGGGA 0: 1
1: 0
2: 0
3: 35
4: 280
Right 1049393054 8:142381871-142381893 GCCGCAGCTCATCCTGCGTGTGG No data
1049393049_1049393054 10 Left 1049393049 8:142381838-142381860 CCTTGGCATTGGGAACAGGCAGC 0: 1
1: 0
2: 3
3: 27
4: 197
Right 1049393054 8:142381871-142381893 GCCGCAGCTCATCCTGCGTGTGG No data
1049393047_1049393054 14 Left 1049393047 8:142381834-142381856 CCTGCCTTGGCATTGGGAACAGG 0: 1
1: 0
2: 2
3: 17
4: 184
Right 1049393054 8:142381871-142381893 GCCGCAGCTCATCCTGCGTGTGG No data
1049393046_1049393054 18 Left 1049393046 8:142381830-142381852 CCTGCCTGCCTTGGCATTGGGAA 0: 1
1: 0
2: 1
3: 26
4: 261
Right 1049393054 8:142381871-142381893 GCCGCAGCTCATCCTGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049393054 Original CRISPR GCCGCAGCTCATCCTGCGTG TGG Intronic
No off target data available for this crispr