ID: 1049394837

View in Genome Browser
Species Human (GRCh38)
Location 8:142395159-142395181
Sequence CACAGGAAAATGCCCACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049394837_1049394847 24 Left 1049394837 8:142395159-142395181 CCCACTGTGGGCATTTTCCTGTG 0: 1
1: 0
2: 0
3: 11
4: 236
Right 1049394847 8:142395206-142395228 CAAGGTCCTGGCCCTGGAGGAGG No data
1049394837_1049394846 21 Left 1049394837 8:142395159-142395181 CCCACTGTGGGCATTTTCCTGTG 0: 1
1: 0
2: 0
3: 11
4: 236
Right 1049394846 8:142395203-142395225 AGACAAGGTCCTGGCCCTGGAGG No data
1049394837_1049394844 12 Left 1049394837 8:142395159-142395181 CCCACTGTGGGCATTTTCCTGTG 0: 1
1: 0
2: 0
3: 11
4: 236
Right 1049394844 8:142395194-142395216 AGACAGAAAAGACAAGGTCCTGG No data
1049394837_1049394845 18 Left 1049394837 8:142395159-142395181 CCCACTGTGGGCATTTTCCTGTG 0: 1
1: 0
2: 0
3: 11
4: 236
Right 1049394845 8:142395200-142395222 AAAAGACAAGGTCCTGGCCCTGG No data
1049394837_1049394843 6 Left 1049394837 8:142395159-142395181 CCCACTGTGGGCATTTTCCTGTG 0: 1
1: 0
2: 0
3: 11
4: 236
Right 1049394843 8:142395188-142395210 CCACAGAGACAGAAAAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049394837 Original CRISPR CACAGGAAAATGCCCACAGT GGG (reversed) Intronic
902614101 1:17614454-17614476 CCCAGGAAAATGCCAAGAGAAGG + Intronic
902954884 1:19918810-19918832 CACAGGGCAAAGCTCACAGTTGG - Intergenic
903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG + Intronic
905149360 1:35915071-35915093 CACAGGACGTAGCCCACAGTAGG - Intronic
906772596 1:48498618-48498640 CACAGGCAAATGCAGACAGAAGG + Intergenic
908054174 1:60265181-60265203 CACAGGGCAAATCCCACAGTAGG - Intergenic
908479034 1:64518827-64518849 AGCAGGAAAATACCCACACTAGG - Intronic
908949991 1:69548702-69548724 CAGAGAGAAATGCACACAGTAGG - Intergenic
911444041 1:97968840-97968862 CAAAGTAAAATGCCCACAAGGGG + Intergenic
912696987 1:111849177-111849199 CACAGCAAACTACCCAAAGTGGG + Intronic
912797375 1:112701229-112701251 CACAGGAAAGTGTCTGCAGTAGG - Exonic
913495707 1:119426397-119426419 CACAGGGGACTCCCCACAGTGGG + Intergenic
917084435 1:171291820-171291842 CACAGGGGACTCCCCACAGTGGG + Intergenic
919657009 1:200206974-200206996 CACAGGATCATGGCCACAGAAGG - Intergenic
921654547 1:217719319-217719341 CACAACAAAATGTCCACATTAGG - Intronic
1063502957 10:6571203-6571225 CACTGGAAAAAGCAGACAGTTGG + Intronic
1064008293 10:11715133-11715155 AGCAGGAAAATGCCCACAGGAGG + Intergenic
1066751007 10:38657103-38657125 CAAAGGCAAAGTCCCACAGTAGG - Intergenic
1067295647 10:44973893-44973915 GACAGGAAAATCCCCCTAGTGGG - Intronic
1067786882 10:49256686-49256708 CCCAGGAAACTGCCTACACTGGG - Intergenic
1069624729 10:69860718-69860740 CTCAGGAAAATGGCCGCAGAAGG - Intronic
1070023027 10:72605560-72605582 CACAGGGCAAACCCCACAGTTGG - Intronic
1070171617 10:73937388-73937410 CACAGGAGAGTGAACACAGTCGG + Intergenic
1073431041 10:103487239-103487261 GAAAGGAAAATGCCCAGTGTTGG - Intergenic
1074976062 10:118582684-118582706 CTCAGGATGATGCACACAGTGGG - Intergenic
1075639991 10:124057596-124057618 TCCAGAAAAATGCCCACATTCGG + Intronic
1075978643 10:126718535-126718557 CCCAGGAACTTGCCCACAGCTGG - Intergenic
1076446746 10:130519498-130519520 CAGAGGAAAATGCCAGCAGGTGG - Intergenic
1076898891 10:133327356-133327378 CCCAGGTGACTGCCCACAGTGGG + Intronic
1077746069 11:4907425-4907447 GACTGGAACATGCCCACATTTGG + Exonic
1078028908 11:7728429-7728451 AACTGGAAAATCCCCACAGAAGG - Intergenic
1079367070 11:19818785-19818807 CATAGCAAAAGGCCCACAGCAGG - Intronic
1082026733 11:47578251-47578273 CTCAGGAAAACACCCAGAGTTGG - Intronic
1082029636 11:47594867-47594889 AATTGGAAAATGCCCACGGTCGG + Intergenic
1083000113 11:59283696-59283718 CACAGAAAGATGGCCACAGAGGG + Intergenic
1083867701 11:65466317-65466339 CACAGGACAATGACCTCAGAAGG + Intergenic
1084575585 11:69986145-69986167 CCCAGGGAAGTCCCCACAGTCGG + Intergenic
1086405595 11:86496707-86496729 CATAAGAAAACCCCCACAGTTGG - Intronic
1087465148 11:98494969-98494991 CCCAGGAAACAGCTCACAGTAGG - Intergenic
1088837808 11:113593061-113593083 GGCAGGAAATTGGCCACAGTGGG - Intergenic
1089296755 11:117473858-117473880 CACAAGCAAGTGCCCACAGCAGG - Intronic
1089813118 11:121147855-121147877 AACAGGGAAATGCACACAGGGGG + Intronic
1090358070 11:126153900-126153922 CACAGGACAAAGGCCTCAGTAGG - Intergenic
1090843633 11:130513599-130513621 CCCAGGAACCTGCACACAGTAGG - Intergenic
1091255000 11:134175609-134175631 CATAGCAAAAGCCCCACAGTGGG - Intronic
1091703945 12:2681164-2681186 CACATGAAAATGCCCTTAGAGGG - Intronic
1091710623 12:2737640-2737662 CACATGAAAATGCCCTTAGAGGG - Intergenic
1091713469 12:2759702-2759724 CACATGAAAATGCCCTTAGAGGG - Intergenic
1092260164 12:6949135-6949157 GGCAGGAAAATGACCACAGACGG - Intronic
1093284911 12:17247110-17247132 CACAGGAAAATTCTGAAAGTTGG + Intergenic
1098605040 12:72380211-72380233 CATAGAAAAATGTCCACGGTAGG - Intronic
1101254772 12:102966161-102966183 TCCAGGAAAATGCACACAGTAGG - Intergenic
1102795625 12:115686911-115686933 TAAAGGAAAAGACCCACAGTTGG - Intergenic
1104736880 12:131140425-131140447 CACAGGATCATGCCCACACATGG - Exonic
1105277152 13:18942859-18942881 CACAGAAAACTTCCCCCAGTGGG - Intergenic
1106547803 13:30745388-30745410 AAAGGGAAAATGCCCACAGAGGG - Intronic
1107366318 13:39681463-39681485 CACAAGACAGAGCCCACAGTTGG - Intronic
1107732372 13:43361165-43361187 CACACGTAAATGCACAGAGTGGG - Intronic
1108014329 13:46058326-46058348 CTCAGGATAAAGTCCACAGTAGG + Exonic
1110537452 13:76668149-76668171 CAGAGGAAAATGCCCAAAGCTGG + Intergenic
1111465693 13:88606404-88606426 CACAGGTAAGTGCCCACTCTCGG + Intergenic
1112447165 13:99474679-99474701 CACGTGAAAATACCAACAGTGGG - Intergenic
1114167019 14:20229947-20229969 CAGAGGACAATGCCATCAGTGGG - Intergenic
1115224160 14:31086064-31086086 TAGAGGTAGATGCCCACAGTGGG - Exonic
1116639262 14:47440226-47440248 CACAGGAAAAAGTACACATTTGG + Intronic
1117280085 14:54231408-54231430 TACAGGAAAATCTCAACAGTCGG + Intergenic
1119033140 14:71208032-71208054 CATAGGAAAACCCCCAGAGTTGG - Intergenic
1119541707 14:75442951-75442973 CACAGGAAACTGCCCTACGTTGG - Intronic
1119741219 14:77014755-77014777 GAAAGGAAAATCCCCACAGTAGG - Intergenic
1120841822 14:89092375-89092397 CACAGGAGCAGGCACACAGTAGG + Intergenic
1124377715 15:29139233-29139255 CACAGGAAAATGGCTCCCGTGGG + Intronic
1126877638 15:53061396-53061418 GGCAAGAAAATGCCCACACTGGG - Intergenic
1126930028 15:53637647-53637669 CACAGGGAAAAGCACACACTTGG - Intronic
1127728829 15:61779281-61779303 CACAGGAAAGTTCCTACATTAGG - Intergenic
1129896559 15:79112582-79112604 CTCAGGAAAATGCATACAGTTGG - Intergenic
1130235533 15:82130042-82130064 CAGAGGAGACTGCCCACTGTGGG + Intergenic
1130387702 15:83426203-83426225 CACAGGAAAGTGTACAAAGTAGG + Intergenic
1130734924 15:86538080-86538102 CTCATGAGACTGCCCACAGTGGG - Intronic
1133665988 16:7968381-7968403 CACAGGAAAATCACCACCATAGG - Intergenic
1134132157 16:11657294-11657316 CACAAGAAAAGGCCTACAGGTGG - Intergenic
1137293798 16:47070869-47070891 CTCTGGAAAATACCCAGAGTGGG - Intergenic
1140201048 16:72894996-72895018 CCCAGCACACTGCCCACAGTTGG - Intronic
1141102522 16:81208514-81208536 CACAGGTAACTGCCCTGAGTCGG + Intergenic
1142411154 16:89917925-89917947 CCCAGGAAGATGCCTGCAGTGGG + Exonic
1143234162 17:5383378-5383400 CACAGGAAACAGCAAACAGTGGG + Exonic
1144630182 17:16867529-16867551 CACAGGTAAATGACCACATGTGG - Intergenic
1144651193 17:17008267-17008289 CACAGGTAAATGACCACATGTGG + Intergenic
1145808753 17:27752477-27752499 CCCAGGAATCAGCCCACAGTAGG + Intergenic
1153927209 18:9844453-9844475 CCCAGGAAGATGCCCAGAGGTGG - Intronic
1155915160 18:31550316-31550338 CACATCAAAATGTCTACAGTAGG + Intergenic
1158462196 18:57656226-57656248 CACAGGAAACAGACCCCAGTTGG - Intronic
1159762651 18:72448062-72448084 TACAGGCACATGCCCACATTCGG + Intergenic
1159780560 18:72656065-72656087 TACAGGAAAATTCCCACCCTAGG + Intergenic
1159998963 18:74997686-74997708 GAGAAGAAAATGGCCACAGTTGG - Intronic
1160711137 19:551436-551458 CACACGAAAACGCACACAGGCGG - Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1163745600 19:19044663-19044685 CACAGAACCAGGCCCACAGTCGG - Intronic
1163810010 19:19425258-19425280 CATAGGAGAATGCACACAGAAGG - Intronic
1164512641 19:28910142-28910164 CACAGGAAAATCCCCCAAATGGG + Intergenic
1165708890 19:37995630-37995652 CACAGGAAAATGGCCTGAGGAGG + Intronic
1165848467 19:38834677-38834699 CACAGTAAATTCCCCAGAGTGGG + Intronic
1166206919 19:41276133-41276155 TGAAGGAAAATGCCCACAGTTGG - Intronic
1167854521 19:52226922-52226944 CACAGGAAATGGCCCACAGGGGG - Exonic
925098561 2:1227295-1227317 CCCTGGAAAGTGCACACAGTAGG - Intronic
927461232 2:23300016-23300038 CAGAGCAAACTGCCCACAGGGGG - Intergenic
927871631 2:26627824-26627846 CAGAGGAAAATGCACAAAGCTGG - Intronic
928843668 2:35642397-35642419 CACTTGAAAATGCCCAGAGAAGG + Intergenic
930237393 2:48901062-48901084 CACAGTACATTGCACACAGTAGG - Intergenic
932606753 2:73170491-73170513 CAAAGGACCATGCACACAGTAGG + Intergenic
933055677 2:77660769-77660791 CCCAGGAAGATTCCCACAGCTGG + Intergenic
933925673 2:87089951-87089973 CAAAGGACCATGCACACAGTAGG - Intergenic
936344822 2:111667414-111667436 TACAGGCAAAGGCACACAGTAGG + Intergenic
936376582 2:111946285-111946307 CCCAGAAAAATGCCCAGAGCAGG + Intronic
937179553 2:119979465-119979487 CACATAAAAATGACGACAGTGGG - Exonic
937527339 2:122787546-122787568 CATAAGAAAATACCCAGAGTGGG - Intergenic
937905586 2:127051297-127051319 CACAGGAAACAGGCCACAGGAGG + Intronic
937984206 2:127631263-127631285 CGCAGGAATAGGCCCACAGGTGG - Exonic
942162709 2:173208495-173208517 AAGAGGAAAATGCCCTAAGTAGG - Intronic
943720041 2:191194333-191194355 CACAGGAAAGTCCCTTCAGTGGG + Intergenic
948124565 2:235555360-235555382 CACAGGAAGATGCTCATAGATGG + Intronic
948454836 2:238100175-238100197 CACAGGGAAAGGCCCACACCAGG - Exonic
948595870 2:239078946-239078968 CACGGGAATTTGGCCACAGTGGG + Intronic
1169033323 20:2430259-2430281 AACAGGAAAATACCCACTCTGGG + Intronic
1169342561 20:4807621-4807643 CCCTAGAAAATTCCCACAGTCGG - Intronic
1169657438 20:7941100-7941122 CACAGAAAAATGGTTACAGTAGG + Intergenic
1170536264 20:17343994-17344016 CACAGAAAACTGCCCACTGCAGG + Intronic
1170607768 20:17886607-17886629 CACAGAAAAATCCCCAAAGAAGG - Intergenic
1170667084 20:18395549-18395571 CCCAGCAAAGTGCCCTCAGTAGG + Intronic
1171798061 20:29581834-29581856 CCCAGGGAAAGGCCCACAGAGGG - Intergenic
1172613983 20:36271592-36271614 CACAGGACAAGGCCCAGAGCAGG + Intergenic
1174184860 20:48699223-48699245 TACAGGAAAATGCTGAAAGTAGG + Intronic
1175069643 20:56322401-56322423 CACAGGACAGTCCCCACTGTAGG - Intergenic
1175413307 20:58785477-58785499 TCCAGGGAAATGCCCACACTGGG - Intergenic
1175628013 20:60505266-60505288 CACAGCAAAATTTCCACACTGGG - Intergenic
1177291865 21:19123057-19123079 CACAGGAAATTGCTCACTTTGGG - Intergenic
1178377756 21:32082033-32082055 TACATGACAATGCCCATAGTGGG - Intergenic
1179217716 21:39381489-39381511 CTCAGGACAATGCAGACAGTAGG - Intronic
1181968038 22:26670258-26670280 CACGGGAAAGGGCCCAAAGTAGG - Intergenic
1182150383 22:28023260-28023282 CACAGCACAATGCCCAGAGTGGG - Intronic
1183297771 22:37042002-37042024 CACAGGACAATGGTCAAAGTCGG - Intergenic
1183342510 22:37289487-37289509 CAGAGGAAAATGCCCAAGGCTGG - Intronic
1184433840 22:44458234-44458256 CACAGGGAGATGCTCCCAGTGGG - Intergenic
1185419404 22:50727127-50727149 GGCAGGAAAATGTCCACACTCGG - Intergenic
949365290 3:3274165-3274187 CAAAGTAAAGAGCCCACAGTAGG + Intergenic
949615269 3:5746789-5746811 CACAAGAAAATGATCAGAGTTGG + Intergenic
949724977 3:7033789-7033811 CCCAGGAAAATGGGGACAGTTGG + Intronic
950539197 3:13599854-13599876 CACATGCACATGCCCACAGCTGG - Intronic
953419949 3:42746777-42746799 CAAAGGAAAATGCTCAGACTTGG - Intronic
954907208 3:54072901-54072923 CAAAAGAAAATGCCCTGAGTGGG + Intergenic
955332573 3:58059857-58059879 CACAGGAAGATGCCCAAACAAGG - Intronic
956608409 3:71096839-71096861 TTCAGGAAAATGGCCACAGCTGG - Intronic
957255780 3:77836185-77836207 CACAGAAAACTTCCCTCAGTGGG - Intergenic
960085517 3:113586435-113586457 CACAGCAAAATGCCAAAAGCTGG + Intronic
961563047 3:127744427-127744449 AACAGGAGAATGGCCACTGTGGG - Intronic
963329228 3:143895452-143895474 CACAAGAAAATTTCCACAGCAGG - Intergenic
965332800 3:167398001-167398023 AAAAGAAAAATGCACACAGTTGG + Intergenic
965988878 3:174791242-174791264 CACAGGAGAATACCCAGAGAGGG - Intronic
967411231 3:189168500-189168522 CACAGTACAATGCCAATAGTAGG - Intronic
968435908 4:589106-589128 CACAGGTGAAGTCCCACAGTAGG + Intergenic
968634035 4:1668595-1668617 CACAGGGGAATGGCCACACTGGG - Intronic
969974947 4:11088913-11088935 CAGTGGTAGATGCCCACAGTTGG + Intergenic
971404300 4:26307168-26307190 CTCAGGACAATGCTGACAGTTGG - Intronic
971683753 4:29736876-29736898 TACAGGAAAATTCACACAATTGG + Intergenic
977824664 4:101516991-101517013 CACAGGAGAATTTCCACAATAGG + Intronic
978331507 4:107618227-107618249 CTTAGGAAGATGACCACAGTAGG + Intronic
978988071 4:115040903-115040925 AACAAGTAATTGCCCACAGTTGG + Intronic
979600542 4:122582629-122582651 GACAGGAATGTGCCCACTGTAGG - Intergenic
980260499 4:130442037-130442059 CACACCAAAATCCCAACAGTAGG - Intergenic
980296055 4:130919205-130919227 GACAGGAAGATGACCAAAGTCGG - Intergenic
980811785 4:137892311-137892333 CAGAGGCAAATGTCCACAGAAGG - Intergenic
985851114 5:2389655-2389677 CCCAGGCACATGCCCACAGCAGG + Intergenic
987021245 5:13874415-13874437 GAAAGGAAAATGACCTCAGTAGG + Intronic
987220115 5:15782753-15782775 CACAAGAAAATGCCTTCACTTGG - Intronic
988790839 5:34606139-34606161 CAGAGGCAAATGCCCAAAGCAGG - Intergenic
991215753 5:64156059-64156081 CAAAAGAGAATGCCCCCAGTGGG + Intergenic
993340416 5:86718521-86718543 GACAGGAAAATGCTCAAAGTTGG + Intergenic
993504066 5:88690623-88690645 CACAAGAAAATGCCCAGATGTGG - Intergenic
995741756 5:115363390-115363412 GACAGGAAATTGCACAAAGTGGG - Intergenic
996611539 5:125386450-125386472 CTGAGGAAAATGCCTGCAGTGGG - Intergenic
999987750 5:157020905-157020927 AACAGGAAAATGTCCACAATAGG - Intergenic
1002344001 5:178535626-178535648 CACAGGAACATGCAAACACTGGG + Intronic
1002866099 6:1123796-1123818 CACAGTACAATGCACATAGTAGG + Intergenic
1002915825 6:1526977-1526999 CACATGTACATGCCCACGGTGGG - Intergenic
1004384599 6:15161861-15161883 CCCAGCAAAATGCACACACTTGG + Intergenic
1004549215 6:16630155-16630177 CCCAAGGGAATGCCCACAGTTGG - Intronic
1006719740 6:36142533-36142555 CACAGGTATTTGCTCACAGTGGG - Intronic
1007799394 6:44379227-44379249 CACAGGAAACTGCTCTCAGAAGG + Intergenic
1008605053 6:53132131-53132153 CAGAGGAAAATGACCACACCTGG + Intronic
1012840407 6:104322537-104322559 CACAGGGGACTGCACACAGTAGG + Intergenic
1014914428 6:127128782-127128804 CAGAGCAAAATGCACACAATAGG + Intronic
1015118234 6:129672477-129672499 CTAAGGAAAAAGCCAACAGTGGG - Intronic
1016625650 6:146164765-146164787 CTCAGGATAATGCCAACACTAGG - Intronic
1016941721 6:149487846-149487868 CACAGGATAGGGGCCACAGTGGG + Intergenic
1018383962 6:163285813-163285835 CAAAGAACATTGCCCACAGTAGG + Intronic
1018538883 6:164854801-164854823 TTCAGGGAAATGCCCACATTTGG - Intergenic
1020373630 7:7461308-7461330 CACTGGGAAAAGCCCACAGGGGG + Intronic
1021105087 7:16629027-16629049 CACAGGAAAATAAGGACAGTTGG - Intronic
1021178182 7:17474759-17474781 CCCAGGAGAAATCCCACAGTAGG - Intergenic
1021999582 7:26213521-26213543 CACAGGAATGTTTCCACAGTTGG + Intergenic
1022066132 7:26859378-26859400 CAGAGCCAAATGCCCAAAGTTGG + Intronic
1022101692 7:27173061-27173083 CACAGGAAAGAGCGCACAGGAGG + Intronic
1024032028 7:45469378-45469400 TAAAGGAAAATCCCCCCAGTGGG + Intergenic
1024037545 7:45521675-45521697 GCAAGGAAAATGCCAACAGTTGG + Intergenic
1025985717 7:66449589-66449611 TATAGGAAAAGGCCCACATTGGG - Intergenic
1026002564 7:66572891-66572913 TATAGGAAAAGGCCCACATTGGG - Intergenic
1028388751 7:90290853-90290875 CACAGGAAAGTGACCACAGCAGG + Intronic
1030145257 7:106346623-106346645 AACAGGAAAAGTCACACAGTTGG + Intergenic
1031510943 7:122648952-122648974 CACTGGCCCATGCCCACAGTAGG + Intronic
1034299169 7:150000365-150000387 AAGAGGTAAATGCCAACAGTGGG - Intergenic
1034806846 7:154096408-154096430 AAGAGGTAAATGCCAACAGTGGG + Intronic
1035742147 8:1936545-1936567 CACAGGAAAGTGTCTTCAGTTGG + Intronic
1035992861 8:4511326-4511348 CACAGGAAAGTGACCAGAGGAGG + Intronic
1038336636 8:26650896-26650918 TACTGTAAAATGCCCTCAGTGGG + Intronic
1038407007 8:27329556-27329578 CCCAGGTAAATGGCCACATTGGG + Intronic
1038409642 8:27348240-27348262 CACAGGAAAAGGGCCAGATTTGG - Intronic
1039328526 8:36511542-36511564 CAGAGGAAAATGCACATAGACGG + Intergenic
1040710969 8:50188369-50188391 CAAAGGAAAATCCTCCCAGTGGG - Intronic
1040945610 8:52881725-52881747 AACAGGGAAATGCCCACAAGGGG + Intergenic
1042667556 8:71223053-71223075 CAGAGGAAAATGCTCCCAGAAGG + Intronic
1043418369 8:80074652-80074674 CATGGTCAAATGCCCACAGTGGG + Intronic
1043420017 8:80088467-80088489 GAGAGGAAAATGACCACTGTAGG - Intronic
1048535662 8:135291837-135291859 CACAGGTGAAGCCCCACAGTGGG - Intergenic
1049359494 8:142205577-142205599 CACAGGCAAGCGCCCTCAGTGGG + Intergenic
1049394837 8:142395159-142395181 CACAGGAAAATGCCCACAGTGGG - Intronic
1049538900 8:143197206-143197228 CACAGCCAAATGCCCCCAGCAGG + Intergenic
1050969411 9:11849970-11849992 CACTGGAAAATGGCAGCAGTAGG + Intergenic
1053415602 9:37945144-37945166 CACATGAAAATGGCCAGAGGCGG + Intronic
1053787955 9:41665620-41665642 CCCAGGGAAAGGCCCACAGAGGG + Intergenic
1054157176 9:61649148-61649170 CCCAGGGAAAGGCCCACAGAGGG - Intergenic
1054176231 9:61876962-61876984 CCCAGGGAAAGGCCCACAGAGGG + Intergenic
1054476951 9:65580153-65580175 CCCAGGGAAAGGCCCACAGAGGG - Intergenic
1054661308 9:67703846-67703868 CCCAGGGAAAGGCCCACAGAGGG - Intergenic
1056930498 9:90872235-90872257 CCCAGGATAATGTCCTCAGTGGG + Intronic
1060410395 9:123396183-123396205 CTGGGGAAAAGGCCCACAGTAGG - Intronic
1061315107 9:129790529-129790551 GACGGGAAACTGCCCACAGCTGG - Intergenic
1061873305 9:133531940-133531962 CACAGCAAAGTGGCCACAGCAGG - Intergenic
1061935967 9:133857838-133857860 CCCAGGAAAAGTCCCAGAGTGGG + Intronic
1062392489 9:136339539-136339561 GACAGGATAATGCCCCCAGCTGG - Intronic
1187416576 X:19098405-19098427 CACAGCAAAATGCCAACTGGAGG + Intronic
1191593316 X:62912958-62912980 CACAGAAGAAAGCCAACAGTGGG - Intergenic
1191755413 X:64587171-64587193 GACAGTAAAAGTCCCACAGTTGG - Intergenic
1194744628 X:97614913-97614935 CACTGGAACTTTCCCACAGTTGG + Intergenic
1195017902 X:100796780-100796802 CACAGGGGACTCCCCACAGTGGG - Intergenic
1196042676 X:111222415-111222437 CCCTTGAAAATGTCCACAGTGGG + Intronic
1196225624 X:113162733-113162755 CACAGGGAAACATCCACAGTTGG - Intergenic
1197972463 X:132129761-132129783 CACAGTGGAAAGCCCACAGTGGG - Intergenic
1198125788 X:133642347-133642369 AACAGGAAAATGTCCAGAGAAGG + Intronic
1199286019 X:146055046-146055068 CACAGAAACAGGCCCACTGTGGG + Intergenic