ID: 1049397707

View in Genome Browser
Species Human (GRCh38)
Location 8:142409282-142409304
Sequence AAAGAGAAGGAGAGAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049397699_1049397707 16 Left 1049397699 8:142409243-142409265 CCTGGGAGTCACTGAGTTGAGTG No data
Right 1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049397707 Original CRISPR AAAGAGAAGGAGAGAGGGGA AGG Intergenic
No off target data available for this crispr