ID: 1049399270

View in Genome Browser
Species Human (GRCh38)
Location 8:142417630-142417652
Sequence TGGGAAAGCAGGCTTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049399270_1049399283 29 Left 1049399270 8:142417630-142417652 CCAGGCAGAAGCCTGCTTTCCCA No data
Right 1049399283 8:142417682-142417704 GACGCTTCCTGATGCTCCCGAGG No data
1049399270_1049399281 7 Left 1049399270 8:142417630-142417652 CCAGGCAGAAGCCTGCTTTCCCA No data
Right 1049399281 8:142417660-142417682 CCCAGTCTGTTTGAATTGGGTGG No data
1049399270_1049399277 3 Left 1049399270 8:142417630-142417652 CCAGGCAGAAGCCTGCTTTCCCA No data
Right 1049399277 8:142417656-142417678 GGACCCCAGTCTGTTTGAATTGG No data
1049399270_1049399278 4 Left 1049399270 8:142417630-142417652 CCAGGCAGAAGCCTGCTTTCCCA No data
Right 1049399278 8:142417657-142417679 GACCCCAGTCTGTTTGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049399270 Original CRISPR TGGGAAAGCAGGCTTCTGCC TGG (reversed) Intergenic