ID: 1049399274

View in Genome Browser
Species Human (GRCh38)
Location 8:142417641-142417663
Sequence TGGGGTCCCCATGGGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049399274_1049399277 -8 Left 1049399274 8:142417641-142417663 CCTGCTTTCCCATGGGGACCCCA No data
Right 1049399277 8:142417656-142417678 GGACCCCAGTCTGTTTGAATTGG No data
1049399274_1049399281 -4 Left 1049399274 8:142417641-142417663 CCTGCTTTCCCATGGGGACCCCA No data
Right 1049399281 8:142417660-142417682 CCCAGTCTGTTTGAATTGGGTGG No data
1049399274_1049399285 23 Left 1049399274 8:142417641-142417663 CCTGCTTTCCCATGGGGACCCCA No data
Right 1049399285 8:142417687-142417709 TTCCTGATGCTCCCGAGGTCGGG No data
1049399274_1049399283 18 Left 1049399274 8:142417641-142417663 CCTGCTTTCCCATGGGGACCCCA No data
Right 1049399283 8:142417682-142417704 GACGCTTCCTGATGCTCCCGAGG No data
1049399274_1049399278 -7 Left 1049399274 8:142417641-142417663 CCTGCTTTCCCATGGGGACCCCA No data
Right 1049399278 8:142417657-142417679 GACCCCAGTCTGTTTGAATTGGG No data
1049399274_1049399284 22 Left 1049399274 8:142417641-142417663 CCTGCTTTCCCATGGGGACCCCA No data
Right 1049399284 8:142417686-142417708 CTTCCTGATGCTCCCGAGGTCGG No data
1049399274_1049399286 24 Left 1049399274 8:142417641-142417663 CCTGCTTTCCCATGGGGACCCCA No data
Right 1049399286 8:142417688-142417710 TCCTGATGCTCCCGAGGTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049399274 Original CRISPR TGGGGTCCCCATGGGAAAGC AGG (reversed) Intergenic