ID: 1049399279

View in Genome Browser
Species Human (GRCh38)
Location 8:142417659-142417681
Sequence CACCCAATTCAAACAGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049399279_1049399283 0 Left 1049399279 8:142417659-142417681 CCCCAGTCTGTTTGAATTGGGTG No data
Right 1049399283 8:142417682-142417704 GACGCTTCCTGATGCTCCCGAGG No data
1049399279_1049399286 6 Left 1049399279 8:142417659-142417681 CCCCAGTCTGTTTGAATTGGGTG No data
Right 1049399286 8:142417688-142417710 TCCTGATGCTCCCGAGGTCGGGG No data
1049399279_1049399284 4 Left 1049399279 8:142417659-142417681 CCCCAGTCTGTTTGAATTGGGTG No data
Right 1049399284 8:142417686-142417708 CTTCCTGATGCTCCCGAGGTCGG No data
1049399279_1049399285 5 Left 1049399279 8:142417659-142417681 CCCCAGTCTGTTTGAATTGGGTG No data
Right 1049399285 8:142417687-142417709 TTCCTGATGCTCCCGAGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049399279 Original CRISPR CACCCAATTCAAACAGACTG GGG (reversed) Intergenic