ID: 1049399282

View in Genome Browser
Species Human (GRCh38)
Location 8:142417661-142417683
Sequence TCCACCCAATTCAAACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049399282_1049399286 4 Left 1049399282 8:142417661-142417683 CCAGTCTGTTTGAATTGGGTGGA No data
Right 1049399286 8:142417688-142417710 TCCTGATGCTCCCGAGGTCGGGG No data
1049399282_1049399283 -2 Left 1049399282 8:142417661-142417683 CCAGTCTGTTTGAATTGGGTGGA No data
Right 1049399283 8:142417682-142417704 GACGCTTCCTGATGCTCCCGAGG No data
1049399282_1049399284 2 Left 1049399282 8:142417661-142417683 CCAGTCTGTTTGAATTGGGTGGA No data
Right 1049399284 8:142417686-142417708 CTTCCTGATGCTCCCGAGGTCGG No data
1049399282_1049399285 3 Left 1049399282 8:142417661-142417683 CCAGTCTGTTTGAATTGGGTGGA No data
Right 1049399285 8:142417687-142417709 TTCCTGATGCTCCCGAGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049399282 Original CRISPR TCCACCCAATTCAAACAGAC TGG (reversed) Intergenic
No off target data available for this crispr