ID: 1049399283

View in Genome Browser
Species Human (GRCh38)
Location 8:142417682-142417704
Sequence GACGCTTCCTGATGCTCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049399275_1049399283 10 Left 1049399275 8:142417649-142417671 CCCATGGGGACCCCAGTCTGTTT No data
Right 1049399283 8:142417682-142417704 GACGCTTCCTGATGCTCCCGAGG No data
1049399280_1049399283 -1 Left 1049399280 8:142417660-142417682 CCCAGTCTGTTTGAATTGGGTGG No data
Right 1049399283 8:142417682-142417704 GACGCTTCCTGATGCTCCCGAGG No data
1049399274_1049399283 18 Left 1049399274 8:142417641-142417663 CCTGCTTTCCCATGGGGACCCCA No data
Right 1049399283 8:142417682-142417704 GACGCTTCCTGATGCTCCCGAGG No data
1049399270_1049399283 29 Left 1049399270 8:142417630-142417652 CCAGGCAGAAGCCTGCTTTCCCA No data
Right 1049399283 8:142417682-142417704 GACGCTTCCTGATGCTCCCGAGG No data
1049399276_1049399283 9 Left 1049399276 8:142417650-142417672 CCATGGGGACCCCAGTCTGTTTG No data
Right 1049399283 8:142417682-142417704 GACGCTTCCTGATGCTCCCGAGG No data
1049399282_1049399283 -2 Left 1049399282 8:142417661-142417683 CCAGTCTGTTTGAATTGGGTGGA No data
Right 1049399283 8:142417682-142417704 GACGCTTCCTGATGCTCCCGAGG No data
1049399279_1049399283 0 Left 1049399279 8:142417659-142417681 CCCCAGTCTGTTTGAATTGGGTG No data
Right 1049399283 8:142417682-142417704 GACGCTTCCTGATGCTCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049399283 Original CRISPR GACGCTTCCTGATGCTCCCG AGG Intergenic
No off target data available for this crispr