ID: 1049399284

View in Genome Browser
Species Human (GRCh38)
Location 8:142417686-142417708
Sequence CTTCCTGATGCTCCCGAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049399279_1049399284 4 Left 1049399279 8:142417659-142417681 CCCCAGTCTGTTTGAATTGGGTG No data
Right 1049399284 8:142417686-142417708 CTTCCTGATGCTCCCGAGGTCGG No data
1049399274_1049399284 22 Left 1049399274 8:142417641-142417663 CCTGCTTTCCCATGGGGACCCCA No data
Right 1049399284 8:142417686-142417708 CTTCCTGATGCTCCCGAGGTCGG No data
1049399275_1049399284 14 Left 1049399275 8:142417649-142417671 CCCATGGGGACCCCAGTCTGTTT No data
Right 1049399284 8:142417686-142417708 CTTCCTGATGCTCCCGAGGTCGG No data
1049399282_1049399284 2 Left 1049399282 8:142417661-142417683 CCAGTCTGTTTGAATTGGGTGGA No data
Right 1049399284 8:142417686-142417708 CTTCCTGATGCTCCCGAGGTCGG No data
1049399280_1049399284 3 Left 1049399280 8:142417660-142417682 CCCAGTCTGTTTGAATTGGGTGG No data
Right 1049399284 8:142417686-142417708 CTTCCTGATGCTCCCGAGGTCGG No data
1049399276_1049399284 13 Left 1049399276 8:142417650-142417672 CCATGGGGACCCCAGTCTGTTTG No data
Right 1049399284 8:142417686-142417708 CTTCCTGATGCTCCCGAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049399284 Original CRISPR CTTCCTGATGCTCCCGAGGT CGG Intergenic