ID: 1049400117

View in Genome Browser
Species Human (GRCh38)
Location 8:142422309-142422331
Sequence CCCTTTCTTGAACTTTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049400117_1049400122 5 Left 1049400117 8:142422309-142422331 CCTCAACAAAGTTCAAGAAAGGG No data
Right 1049400122 8:142422337-142422359 TTGGATGGTAAATATGCACATGG No data
1049400117_1049400121 -10 Left 1049400117 8:142422309-142422331 CCTCAACAAAGTTCAAGAAAGGG No data
Right 1049400121 8:142422322-142422344 CAAGAAAGGGGATATTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049400117 Original CRISPR CCCTTTCTTGAACTTTGTTG AGG (reversed) Intergenic
No off target data available for this crispr