ID: 1049403374

View in Genome Browser
Species Human (GRCh38)
Location 8:142440807-142440829
Sequence CTGGGTAGACAGAGGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 0, 2: 7, 3: 67, 4: 578}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049403374_1049403385 2 Left 1049403374 8:142440807-142440829 CCTCCTGCCCTCTGTCTACCCAG 0: 1
1: 0
2: 7
3: 67
4: 578
Right 1049403385 8:142440832-142440854 CCCAGGCTGGGCTGTGTCCTGGG 0: 1
1: 1
2: 4
3: 64
4: 592
1049403374_1049403387 3 Left 1049403374 8:142440807-142440829 CCTCCTGCCCTCTGTCTACCCAG 0: 1
1: 0
2: 7
3: 67
4: 578
Right 1049403387 8:142440833-142440855 CCAGGCTGGGCTGTGTCCTGGGG 0: 1
1: 0
2: 5
3: 86
4: 581
1049403374_1049403388 15 Left 1049403374 8:142440807-142440829 CCTCCTGCCCTCTGTCTACCCAG 0: 1
1: 0
2: 7
3: 67
4: 578
Right 1049403388 8:142440845-142440867 GTGTCCTGGGGTACCCAGACCGG 0: 1
1: 0
2: 0
3: 16
4: 170
1049403374_1049403380 -10 Left 1049403374 8:142440807-142440829 CCTCCTGCCCTCTGTCTACCCAG 0: 1
1: 0
2: 7
3: 67
4: 578
Right 1049403380 8:142440820-142440842 GTCTACCCAGCTCCCAGGCTGGG 0: 1
1: 0
2: 1
3: 27
4: 221
1049403374_1049403383 1 Left 1049403374 8:142440807-142440829 CCTCCTGCCCTCTGTCTACCCAG 0: 1
1: 0
2: 7
3: 67
4: 578
Right 1049403383 8:142440831-142440853 TCCCAGGCTGGGCTGTGTCCTGG 0: 2
1: 1
2: 5
3: 61
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049403374 Original CRISPR CTGGGTAGACAGAGGGCAGG AGG (reversed) Intergenic
900124103 1:1061993-1062015 TGGGGAAGACAGAGGGCTGGGGG + Intergenic
900345824 1:2209838-2209860 CTGTCTGGACAGAAGGCAGGAGG - Intronic
900458199 1:2787446-2787468 GGGGGGTGACAGAGGGCAGGTGG - Intronic
901063327 1:6483888-6483910 CTGGGTTCACAGAGGGCCAGAGG - Intronic
901069539 1:6510215-6510237 CAGGAGAGCCAGAGGGCAGGGGG - Intronic
901468479 1:9439136-9439158 CTGGGGAGACTCAGGGCAGAAGG + Intergenic
902059588 1:13630932-13630954 AAGTGTATACAGAGGGCAGGTGG - Intergenic
902069307 1:13720357-13720379 CTGGGTAGGGAGAGTGGAGGAGG + Intronic
902075010 1:13777497-13777519 CTGGGCAAAGTGAGGGCAGGAGG - Intronic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902415756 1:16237853-16237875 CTGGTTGGAAAGAGTGCAGGTGG + Intergenic
902642154 1:17773990-17774012 GTGGGTAGACTGAGGCCAGATGG + Intronic
902668078 1:17953293-17953315 CTGGGGAGACACTGGGCACGTGG + Intergenic
902691747 1:18114156-18114178 AGGGAAAGACAGAGGGCAGGCGG - Intronic
902743580 1:18457812-18457834 CTGGGTAGACTGAGGGAACAAGG + Intergenic
903169216 1:21541710-21541732 TAGGGTAGGGAGAGGGCAGGGGG + Intronic
903221632 1:21872761-21872783 CTGGGTAGACGGATGGAAGGAGG + Intronic
903304235 1:22401458-22401480 GTGGGAAGGCAGTGGGCAGGAGG - Intergenic
903891494 1:26573201-26573223 CTGGGGACACAGTGGGCAAGGGG - Intronic
904193392 1:28765107-28765129 CTGGGGAGGCTGAAGGCAGGAGG - Intronic
904456225 1:30649801-30649823 CTGGGCAGGCAGAGAGGAGGTGG - Intergenic
904673118 1:32180528-32180550 CTGCGTTGCCAGCGGGCAGGGGG + Intronic
905774824 1:40661833-40661855 CTGGGGAGCCAGAGGGCAAGAGG - Intronic
905888467 1:41504605-41504627 CTGAGCAGACAGAGGGCAGCCGG + Intergenic
906484820 1:46226160-46226182 CAGGGTGGAAAGTGGGCAGGAGG + Intergenic
906705859 1:47894918-47894940 CTGGGTAGGAAGAGCTCAGGAGG + Intronic
906816561 1:48886056-48886078 TTGGGGAGAGAGAGGTCAGGTGG + Intronic
906978961 1:50607850-50607872 CTGAGTAGACAGAGGCAATGTGG + Intronic
907403631 1:54240751-54240773 CTGGGCATTTAGAGGGCAGGGGG - Intronic
909901194 1:81137799-81137821 CTAAGTAGACAGACAGCAGGTGG + Intergenic
912100712 1:106201320-106201342 CTGGGAGGACAGTGGGGAGGAGG - Intergenic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
912744865 1:112237747-112237769 CTGAGTAATCAGAGGGTAGGAGG - Intergenic
912933015 1:113981166-113981188 CTGGGTAGGCACAGGGCAGCTGG + Exonic
915110492 1:153561707-153561729 CTGGGTATAAGGTGGGCAGGAGG + Intronic
915117059 1:153607842-153607864 CTGAGAAGACAGAGGCCTGGGGG + Intronic
915326338 1:155082932-155082954 GTTGGTACACAGAGGGCACGGGG - Intronic
915597936 1:156905973-156905995 CTGTCCAGAGAGAGGGCAGGTGG - Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
915732749 1:158065834-158065856 CTGAGGGGAAAGAGGGCAGGCGG - Intronic
915962580 1:160279425-160279447 ATGGGATGACAGAGGGCAGCGGG + Exonic
916086591 1:161274807-161274829 CTGGCTAGAAAGAGGGAAGAGGG + Intronic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916737092 1:167617670-167617692 TGGGGTAGAGGGAGGGCAGGGGG + Intergenic
916958659 1:169866631-169866653 CTGAGAACACACAGGGCAGGAGG - Intronic
917401464 1:174653588-174653610 CTGGTTAGACAGTGGGTACGGGG - Intronic
917747982 1:178029054-178029076 TTGGATAGCCAGAGGGCAGCTGG - Intergenic
918485670 1:185026278-185026300 CAGGAGAGACAGAGAGCAGGGGG + Intergenic
918535750 1:185572733-185572755 CTGGATAGAATGAGGGCAGCAGG - Intergenic
919866745 1:201788445-201788467 CTGGAAGGACAGAGGGAAGGGGG - Intronic
920309266 1:205039052-205039074 CTGGATGGACAGAGAGGAGGTGG - Intergenic
920496872 1:206461179-206461201 CTGGGTGTGCAGAGGGCTGGAGG - Exonic
921040876 1:211430676-211430698 TTTGGGAGGCAGAGGGCAGGTGG - Intergenic
921382484 1:214538745-214538767 TGGGGGAGACAGAGGGCAGAAGG + Intronic
921767111 1:218984770-218984792 CTGGGAAGACATCAGGCAGGAGG + Intergenic
922027205 1:221761482-221761504 CAGGGCAGACAAATGGCAGGTGG + Intergenic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922415563 1:225419227-225419249 CTGGGCCCAGAGAGGGCAGGTGG - Intronic
922717654 1:227885647-227885669 ATGGGTAAAGAGAGGGCAGCAGG + Intergenic
923144398 1:231187735-231187757 CTGGGTAGCCAGAGGGACAGCGG + Intronic
923622319 1:235588770-235588792 CTGTGTAGACAGAGGGGCTGAGG - Intronic
923754064 1:236774038-236774060 CTGGTTAGACAGTGAGCAGTGGG + Intergenic
1063390918 10:5649414-5649436 GCAGGTAGACACAGGGCAGGGGG - Intronic
1063911522 10:10835331-10835353 CTGGGAAGACTGAGGCCAGAGGG - Intergenic
1064188953 10:13188640-13188662 CTTTGTAGAAAGAGGGCAAGGGG + Intronic
1064336751 10:14450287-14450309 CTAGGCTGACAGAGGGCAGCTGG + Intronic
1064444644 10:15382764-15382786 CTGGGTAGATGGAGTGAAGGAGG - Intergenic
1065655754 10:27947801-27947823 CTGCGTAGACCTGGGGCAGGAGG - Intronic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1067242234 10:44506715-44506737 CTGTGTTGGCAGAGGGCTGGGGG + Intergenic
1067414389 10:46092429-46092451 CTGGGTACCCAGATGGCATGAGG + Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1069601290 10:69709821-69709843 CTGGGCAGACAGAGGGCTCCCGG + Intergenic
1069679909 10:70277147-70277169 CTGGGGAGGCAGAGGCCAGATGG - Intronic
1069703471 10:70442229-70442251 TGGGGAAGACAGAAGGCAGGAGG + Intronic
1069735103 10:70648895-70648917 GAGGGAAGTCAGAGGGCAGGTGG - Intergenic
1069760758 10:70809453-70809475 GTGGGTAGACAGAGGACCAGTGG - Intergenic
1069821880 10:71233518-71233540 GTGGGGAGGCAGAGGGAAGGGGG - Intronic
1069903770 10:71720457-71720479 CTGGGGAGAAAGAAGGCTGGGGG - Intronic
1070744390 10:78924151-78924173 CTGGGTAGGAACAGGGCTGGTGG + Intergenic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1070772362 10:79089805-79089827 CTGGGTAAAAAGGGAGCAGGTGG - Intronic
1070792203 10:79196265-79196287 GTGGGTAGATGGATGGCAGGAGG - Intronic
1071102112 10:82050793-82050815 CTGGAGAGACAGAGAGTAGGAGG - Intronic
1071695275 10:87863482-87863504 CTCGGAAGACCGAGGGGAGGCGG - Exonic
1072653405 10:97313123-97313145 CTGGTTAGACAGTGGGGAGTGGG - Intergenic
1072719493 10:97771911-97771933 CTGGGTAGAGTCAGGGCCGGGGG - Exonic
1074843511 10:117376563-117376585 CTAAGTAGTCAGAGGGCAGGAGG - Intergenic
1075004007 10:118817682-118817704 TTGGGAACACAGAGGGCAGAAGG + Intergenic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1075518199 10:123126484-123126506 AAGGCTGGACAGAGGGCAGGAGG - Intergenic
1075666424 10:124234001-124234023 CCTGGTGGACAGAGGGCTGGGGG - Intergenic
1076322351 10:129592729-129592751 CTGGCTTAACAGAAGGCAGGTGG - Intronic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076687352 10:132204112-132204134 CTGGGCAGACAGCGGGCAGGAGG - Intronic
1076732507 10:132445761-132445783 CTGGGAGGGCAGAGGACAGGTGG + Exonic
1077301813 11:1850879-1850901 TTGGGTAGGCAGAGGGGAGGAGG + Intergenic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1078934736 11:15941026-15941048 CTGGGCAGGCAGAGGGCCGGTGG - Intergenic
1080679562 11:34461416-34461438 CTGCGTGGGCAGAGGGCACGTGG + Intronic
1081424381 11:42909158-42909180 TTGGGTAGACAGTGTGCAGTTGG - Intergenic
1081601955 11:44501446-44501468 TGGGGTAGGCAGAGGGCAGAGGG - Intergenic
1081746231 11:45474276-45474298 CTGGGTAGGCAGGAGGCTGGTGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083283283 11:61640855-61640877 CTGAGTAGACCTAGGGCTGGGGG - Intergenic
1084013517 11:66365712-66365734 CTGGGGACACAGAGGTCAGCTGG + Intronic
1084085411 11:66852837-66852859 CTGGGGAGAAAGCGGGCAGTGGG + Intronic
1084153549 11:67302183-67302205 CTGGGTGGACCGGGGGCTGGGGG - Exonic
1084313774 11:68331961-68331983 CTGGGCTGGGAGAGGGCAGGTGG + Intronic
1084411630 11:69009329-69009351 CTAGGTTGGCTGAGGGCAGGAGG + Intronic
1084495248 11:69499666-69499688 CTGAGTAGACAGAGTGAAAGGGG - Intergenic
1084643092 11:70437443-70437465 CTGGGCAGACAGTGGGCCAGCGG - Intergenic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1085298336 11:75443434-75443456 CAGGGAAGACAGTGGGCTGGTGG + Intronic
1085300430 11:75455357-75455379 GTGAGTAGAGTGAGGGCAGGAGG + Intronic
1085527941 11:77174923-77174945 CTGAGTGCACAGAGGGCAGGAGG + Intronic
1085647759 11:78238386-78238408 CTTGGGAGGCTGAGGGCAGGAGG + Intronic
1086436288 11:86784203-86784225 CTGGGAAGGCAGGGGACAGGTGG - Intergenic
1088724958 11:112626035-112626057 CTGGGGAGACAATGGACAGGGGG + Intergenic
1089104127 11:115987908-115987930 CTGGGTAGACAGAGAGGAGTAGG - Intergenic
1089257982 11:117204052-117204074 CTAGGGAGACTGAGCGCAGGAGG - Intronic
1089306096 11:117527298-117527320 GTGGGGTGGCAGAGGGCAGGAGG - Intronic
1091255881 11:134184997-134185019 CTGACTAGAGAAAGGGCAGGAGG + Exonic
1091641506 12:2240806-2240828 CTGGGCTGCCAGAGGTCAGGGGG - Intronic
1091816330 12:3441526-3441548 CTGGGGAGACACAGGGTATGAGG - Intronic
1092540847 12:9419069-9419091 CTGGGTGGACAGATGGGAGCTGG - Intergenic
1093697012 12:22172228-22172250 CTGGTTAGAAAGTGGGCAAGAGG + Intronic
1093769506 12:23002590-23002612 CTGGGTAGACAAGGGGGCGGGGG + Intergenic
1093904231 12:24671111-24671133 GTGGGTAGAGAATGGGCAGGGGG + Intergenic
1094673766 12:32597752-32597774 ATGGGCAGACAGAGGTGAGGGGG + Intronic
1095694715 12:45131662-45131684 CTGAGTAGAAACAGTGCAGGAGG + Intergenic
1096805967 12:54141298-54141320 CTGGGGAGAGAGGGGACAGGTGG - Intergenic
1098908686 12:76187662-76187684 CTGGGGAGACAGAGGTGAGGAGG - Intergenic
1101688486 12:107050206-107050228 CTGGGAAGAAAGATGGCAAGGGG + Intronic
1101858485 12:108463621-108463643 CTGGGAAGGCAGAGAGGAGGTGG - Intergenic
1102146129 12:110656321-110656343 ATGGGCTGACAGAGGACAGGTGG + Intronic
1102172446 12:110852585-110852607 TTGGGTACACAGGGAGCAGGAGG + Intronic
1102409426 12:112704429-112704451 ATGGAGAGACAGAGGGAAGGTGG + Intronic
1102575468 12:113853607-113853629 CTGGGTAAAGAGAGAGGAGGTGG + Intronic
1102889836 12:116549965-116549987 CCGGGAAGACAGAGTGCAGGTGG - Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103815359 12:123650740-123650762 GGGGCTAGCCAGAGGGCAGGGGG - Intronic
1104282546 12:127391148-127391170 CTGGGAAGTCAGAGAGCAGCAGG - Intergenic
1104972742 12:132539366-132539388 CTGGGTGGACATGGGGCTGGAGG - Intronic
1104972752 12:132539395-132539417 CTGGGTGGACATGGGGCTGGAGG - Intronic
1105255109 13:18739236-18739258 CTGGTTAGGCAATGGGCAGGTGG - Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106309038 13:28536861-28536883 CTGGGTTGACAGAGGTCAGAAGG + Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1107809715 13:44188680-44188702 CTGGGTAGACTGGAAGCAGGAGG - Intergenic
1109862925 13:68224425-68224447 CTAGGAAGACACAAGGCAGGGGG + Intergenic
1111218637 13:85177379-85177401 CACGGGAGACAGAGGGGAGGAGG - Intergenic
1112331050 13:98477283-98477305 CTGGGTGGACAGTGGGGAGGAGG + Intronic
1113246633 13:108403685-108403707 CTGGCTAAATAGAGAGCAGGTGG + Intergenic
1113510830 13:110853709-110853731 CTTGGTAGACTGAGGGGAGCTGG - Intergenic
1113676327 13:112209975-112209997 GTGGGCAGGCAGGGGGCAGGCGG + Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114659508 14:24335335-24335357 GTGGGGAGACCGAGGGCGGGGGG + Intronic
1115752963 14:36508506-36508528 CTGGGGAGACTGAGAGCTGGGGG + Intronic
1115853835 14:37608870-37608892 CTGGGTAGCAAGAGGACTGGTGG + Intronic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1118152867 14:63208645-63208667 TTGGGAAGACAGAGGGGAGGTGG - Intronic
1118383935 14:65239683-65239705 CAGGGCAGACAGAGGCCAGGAGG + Intergenic
1119182167 14:72612592-72612614 CAGGGAAGGGAGAGGGCAGGAGG + Intergenic
1119562924 14:75605311-75605333 CTAGGTAGAAAGAAGTCAGGAGG - Intronic
1119902275 14:78271674-78271696 CTGGGCAGGCAGCGGCCAGGAGG - Intronic
1121321695 14:92995266-92995288 GTGGGTGAGCAGAGGGCAGGGGG - Intronic
1121717954 14:96089647-96089669 CTGGGCAGAGAGAGAGCAGTGGG - Exonic
1122303154 14:100743413-100743435 CTGGGGAGACTGAGGTGAGGAGG - Intergenic
1122848647 14:104514596-104514618 CTGGGCAGTGAGAAGGCAGGTGG + Intronic
1122858033 14:104569246-104569268 TTGGGGAGGCTGAGGGCAGGAGG - Intronic
1123018766 14:105387795-105387817 CTGGCTCGGCAGAGGGCAGGTGG + Intronic
1123022636 14:105408811-105408833 CTGAGTAGACAGAATGCTGGTGG - Intronic
1123142376 14:106093960-106093982 CTGAGCACACAGAGGGCAGCAGG + Intergenic
1123149697 14:106169163-106169185 CTGAGCACACAGAGGGCAGCAGG + Intergenic
1123797292 15:23784288-23784310 CTGGACAGAGAGAGGTCAGGGGG + Intergenic
1124432239 15:29617717-29617739 GTGGGTGGACATTGGGCAGGAGG + Intergenic
1124700750 15:31909886-31909908 CTGGGTACCCAGAAGGCAGGGGG + Intergenic
1125282955 15:38062500-38062522 CTGGGGAAACCGAGGGCTGGAGG - Intergenic
1125714331 15:41810763-41810785 CTGGGTAGAAAGAGCTCAGAAGG - Intronic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1126382818 15:48066373-48066395 CAGGGCAGAAAGAGGGCAGGGGG - Intergenic
1126915070 15:53457289-53457311 CTGGGGGAACAGGGGGCAGGTGG - Intergenic
1127467056 15:59254430-59254452 TTGGGAAGCCAGGGGGCAGGAGG - Intronic
1127497147 15:59524092-59524114 GAGGGTAGTCAGATGGCAGGAGG - Intergenic
1127857208 15:62962566-62962588 CTGGCCAGGCAGAGGGCAGAGGG - Intergenic
1128110384 15:65072278-65072300 CTGGGAAGCCAGAGGCCTGGAGG - Intronic
1128254800 15:66188704-66188726 CTGGGTAGACAAGGGCCAGTAGG - Intronic
1128519274 15:68364832-68364854 CTGGGCAGAGGGCGGGCAGGAGG - Intronic
1128904025 15:71451598-71451620 CTTGGTAGACAGAGGCATGGGGG + Intronic
1129452395 15:75658378-75658400 CGAGGCAGACAGAGGGCAGGTGG - Exonic
1129515297 15:76153608-76153630 GTGAGCAGGCAGAGGGCAGGAGG + Intronic
1129672249 15:77613860-77613882 CCTGGTAGAAGGAGGGCAGGTGG + Exonic
1129737610 15:77974890-77974912 CTGGGTGGCCTTAGGGCAGGTGG - Intergenic
1129848463 15:78778729-78778751 CTGGGTGGCCTCAGGGCAGGTGG + Intronic
1130044754 15:80435172-80435194 GAGGGCAGGCAGAGGGCAGGAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130253459 15:82315218-82315240 CTGGGTGGACTCAGGGTAGGTGG - Intergenic
1131023120 15:89116531-89116553 CTGAGCATACAGAGGGCATGAGG - Intronic
1131397372 15:92097387-92097409 GCGGGTAGACAGATGGCTGGAGG + Intronic
1132049332 15:98593922-98593944 CTTGGGAGGCAGAGGGCAGAAGG - Intergenic
1132582312 16:690505-690527 CTGCGTTGGCAGAGGCCAGGAGG + Intronic
1132593040 16:734737-734759 CTGGGCAGGCAGAGGCCAGCAGG + Exonic
1132638532 16:966130-966152 CTGGGAAGGCAGAGGCCAGGTGG + Intronic
1132665594 16:1080099-1080121 TGGGGTAGACACAGGGCAGTAGG + Exonic
1132712021 16:1273085-1273107 ATGGGTAGACAGATGGTAGATGG + Intergenic
1132730956 16:1361849-1361871 CTGGGGACACAGATGGCATGAGG - Intronic
1132771910 16:1568161-1568183 CTGGGAGGACAGAGGTGAGGAGG + Intronic
1133441298 16:5823163-5823185 CTGGGCACATAGAGGGCAGTCGG + Intergenic
1134056830 16:11175325-11175347 CTGGGGAGACAGAGCCGAGGGGG - Intronic
1135160998 16:20096324-20096346 CCTGGTTGACAGAGGGCAGGTGG + Intergenic
1135332466 16:21572297-21572319 TTTGGTAGGCTGAGGGCAGGCGG + Intergenic
1136074228 16:27805930-27805952 CTGGGTAGAAAGAGGCCTTGGGG - Intronic
1136155661 16:28380380-28380402 CTGGGAAGAAAGAAGGCAGAGGG + Intronic
1136207423 16:28734909-28734931 CTGGGAAGAAAGAAGGCAGAGGG - Intronic
1136222335 16:28836426-28836448 CTGGGGAGGCAGTGGGGAGGGGG - Exonic
1136580806 16:31149808-31149830 CTGGGGAGACGGAGGCTAGGAGG - Intronic
1136710627 16:32234025-32234047 CTGGGTAGGCAGAGGTGAGCAGG - Intergenic
1136757284 16:32695386-32695408 CTGGGTAGGCAGAGGTGAGTAGG + Intergenic
1136810824 16:33174989-33175011 CTGGGTAGGCAGAGGTGAGCAGG - Intergenic
1136817300 16:33285069-33285091 CTGGGTAGGCAGAGGTGAGCAGG - Intronic
1136823863 16:33341598-33341620 CTGGGTAGGCAGAGGTGAGCAGG - Intergenic
1137053968 16:35734724-35734746 ATGGGAAGACAGGGGGCTGGAGG + Intergenic
1137054040 16:35734959-35734981 CTGGGGAGACTGGGGGCTGGAGG + Intergenic
1137054302 16:35735960-35735982 CTGGGGAGACTGGGGGCTGGAGG + Intergenic
1137056458 16:35748631-35748653 CTGGGGAGACCAAGGGCTGGAGG + Intergenic
1137056791 16:35749889-35749911 CTGGGGAGACCGGGGGCTGGAGG + Intergenic
1137057387 16:35752162-35752184 CTGGGGAGACTGGGGGCTGGAGG + Intergenic
1137057837 16:35753906-35753928 CTGGGGAGACCGAGGGCTGGAGG + Intergenic
1137385912 16:48042470-48042492 CTGGGTGGAAAGAAGGAAGGAGG - Intergenic
1137564245 16:49523446-49523468 CTGGGCTGGCAGAGGCCAGGGGG + Intronic
1137921058 16:52489003-52489025 ATGGGTAAACAGAGGCCATGAGG + Intronic
1138348029 16:56331807-56331829 CTGAGTAGGCAGAAGTCAGGAGG - Intronic
1140219518 16:73033508-73033530 CTGGGGGGAAAGGGGGCAGGCGG + Intronic
1140310613 16:73844810-73844832 ATGGGTAGACAGATGGTAGACGG + Intergenic
1141557197 16:84844022-84844044 CTGGGTGTGCAGAGGGCAGGAGG + Intronic
1142104376 16:88294481-88294503 CTGGGAGCCCAGAGGGCAGGAGG - Intergenic
1142188304 16:88705349-88705371 CAGGGGAGAGAGAGAGCAGGAGG - Intronic
1142236387 16:88924484-88924506 ATGGGCAGACACAGGCCAGGGGG + Intronic
1142358509 16:89615329-89615351 CTGGGTACAGAGCGGGCAGGCGG + Intronic
1203059434 16_KI270728v1_random:955737-955759 CTGGGTAGGCAGAGGTGAGCAGG + Intergenic
1142510499 17:389718-389740 CTGGTCAGACAGTGGGAAGGAGG - Intergenic
1142559727 17:802889-802911 ATGGGTGGATGGAGGGCAGGGGG + Intronic
1142915389 17:3132373-3132395 CTGGGTAGATGAAAGGCAGGAGG + Intergenic
1143016028 17:3891832-3891854 CTTGGTGGACAGAGCCCAGGAGG + Intronic
1143500129 17:7334033-7334055 CAGGGAAGAAAGAGGGCAGCTGG + Intergenic
1143955339 17:10663644-10663666 CTGGGGGGACACAGGACAGGAGG + Intergenic
1144274857 17:13656463-13656485 GTGGGGACACAGAGGGAAGGGGG + Intergenic
1144679703 17:17184800-17184822 CTGGGTAGAGACAGAGCAGGAGG - Intronic
1144876234 17:18398920-18398942 CTGGGCAGCTGGAGGGCAGGAGG - Intergenic
1144966249 17:19078525-19078547 CTGGATGGAAGGAGGGCAGGGGG + Intergenic
1144981669 17:19173532-19173554 CTGGATGGAAGGAGGGCAGGGGG - Intergenic
1144986555 17:19204707-19204729 CTGGATGGAAGGAGGGCAGGGGG + Intergenic
1145013512 17:19382821-19382843 CTGAGAACACAGGGGGCAGGGGG - Exonic
1145155994 17:20545500-20545522 CTGGGCAGCTGGAGGGCAGGAGG + Intergenic
1145302729 17:21652596-21652618 CAGAGGAGACAGAGGGCAGGAGG - Intergenic
1145347574 17:22050592-22050614 CAGAGGAGACAGAGGGCAGGAGG + Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1145813958 17:27782142-27782164 CTGGGTAGACAGAGGCTTTGAGG + Intronic
1146400602 17:32497580-32497602 CAGGGACAACAGAGGGCAGGAGG - Intronic
1146855767 17:36257506-36257528 CTGGGCAGCTGGAGGGCAGGAGG + Intronic
1146931506 17:36781269-36781291 CTGGGAAGAGGGAAGGCAGGAGG + Intergenic
1147317621 17:39628253-39628275 GGGGGGAGATAGAGGGCAGGGGG + Intronic
1147645976 17:42034165-42034187 CTGGGCAGGGAGAGGGCTGGAGG - Intronic
1147946377 17:44082566-44082588 CTGGGTAGGCAGTGAGCTGGTGG - Exonic
1148514295 17:48201488-48201510 CTTGGGAGGCTGAGGGCAGGAGG - Intronic
1148582848 17:48755336-48755358 GTGGGTAGTTATAGGGCAGGTGG - Intergenic
1149638587 17:58189300-58189322 AGGGGGACACAGAGGGCAGGGGG + Intergenic
1150207345 17:63419101-63419123 CTGGGGAGGAGGAGGGCAGGAGG - Intronic
1150767644 17:68014863-68014885 CTGGAAAGATAGAGGGGAGGGGG - Intergenic
1151903021 17:77029836-77029858 TTTGGGAGGCAGAGGGCAGGTGG + Intergenic
1152446855 17:80349925-80349947 CTGGGGAGGGAGAGGGCAGCAGG - Intronic
1152587891 17:81197177-81197199 GTGGGAAGCCGGAGGGCAGGTGG + Intronic
1153676302 18:7458645-7458667 CTGGGGTGACATAGGGCAGGGGG + Intergenic
1154435913 18:14341366-14341388 CTGGTTAGGCAATGGGCAGGTGG + Intergenic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1154971380 18:21413163-21413185 CTGGACACACAGAGGGCAGCAGG - Intronic
1155157508 18:23169919-23169941 ATGGGCAGCCGGAGGGCAGGTGG + Intronic
1155225261 18:23724421-23724443 CTGGGGAGACAGAGGACATCAGG - Intronic
1155344722 18:24847074-24847096 CTGGCCAGGCAGAGGGCAGCTGG - Intergenic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1156175929 18:34546250-34546272 TTGGTTAGACAGAGGCCAGAAGG - Intronic
1156895327 18:42239729-42239751 CTGGGTAGAGAGAGGCAAGCGGG - Intergenic
1157500816 18:48189478-48189500 ATGGGAAGACAGAGGGGACGAGG - Intronic
1157714192 18:49871867-49871889 ATGGGTAGACATAGGGCAGAGGG - Intronic
1157828346 18:50833005-50833027 CTTGGAAGACAGAGGGCAGGTGG - Intergenic
1159513141 18:69422192-69422214 GTGGGTGGAGAGAGGGCATGAGG - Intronic
1159752872 18:72324665-72324687 CTGAGCAGAAAGGGGGCAGGAGG - Intergenic
1160072162 18:75638624-75638646 CTGGGGAGACACAGGGCAAGGGG - Intergenic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1160419604 18:78735098-78735120 CTGGGCAGACCCAGAGCAGGAGG - Intergenic
1160974632 19:1786839-1786861 ATGGGTAGACAGAGGCACGGGGG + Intronic
1161053186 19:2176214-2176236 CTGTGTGGACCGAGGGCTGGGGG - Intronic
1161161218 19:2762759-2762781 CTGAGCTGACAGCGGGCAGGGGG - Intronic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1161766752 19:6212747-6212769 CTGGGCAGAGACAGGGCCGGGGG - Intergenic
1162499615 19:11044791-11044813 CTGGGTAGAACGAGGGCTGCAGG - Intronic
1162791800 19:13066864-13066886 CAGGGCAGCCAGAGGGCCGGGGG - Intronic
1162947788 19:14054278-14054300 CTGGGAACAGAGAGGGAAGGAGG - Exonic
1163019124 19:14473302-14473324 CTGGGACGACAAAGGGCGGGAGG + Intronic
1163119609 19:15209329-15209351 CTGGCTTCTCAGAGGGCAGGAGG + Intergenic
1163133745 19:15294057-15294079 ATGAGTAGACTGAGGGCTGGGGG + Intronic
1163469376 19:17487633-17487655 CTGGGGACAGAGAGGGCAGCTGG + Intronic
1163897047 19:20068436-20068458 TTGGGTTTACAGAGGGGAGGGGG - Intergenic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1164629426 19:29752464-29752486 CTGCATAGGCAGAGGGCTGGGGG + Intergenic
1165339522 19:35200788-35200810 CTGTGACCACAGAGGGCAGGAGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1166042465 19:40212319-40212341 GTGCCCAGACAGAGGGCAGGGGG - Intronic
1166727023 19:45034561-45034583 CTGGGTGGGCAGAGGGTAAGTGG + Intronic
1167101897 19:47408825-47408847 CTGGGTGGATGGTGGGCAGGTGG + Intronic
1167331991 19:48861693-48861715 CTGGGGAGAGAGATGGGAGGAGG + Intronic
1167381897 19:49143052-49143074 TTGGCTAGACTGAGGGCAAGAGG - Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167561899 19:50231099-50231121 TTGGGCAGCCAGAGGGCAGGAGG - Intronic
1167660145 19:50791627-50791649 CGGGGTGGAGAGAGGGCACGCGG - Intronic
1167730610 19:51251500-51251522 CTGGTCAGCCAGAGGGCAGCTGG + Intronic
1168317693 19:55491186-55491208 CTGGGCATGCAGAGAGCAGGCGG - Intronic
925134061 2:1514438-1514460 CTGGGCAGACAGAGGGCACTGGG - Intronic
926216758 2:10910741-10910763 CTGTGGAGACAGGGGGCATGTGG - Intergenic
926702811 2:15815114-15815136 CTGGTGAGACAGAAGGCACGTGG - Intergenic
927312599 2:21647964-21647986 CTGGGGAGACCCAGGGCGGGGGG + Intergenic
927943196 2:27118658-27118680 CTGTGTACCCTGAGGGCAGGTGG - Intronic
928723731 2:34148067-34148089 CTGGGCCTTCAGAGGGCAGGAGG + Intergenic
928815702 2:35292462-35292484 CTGGTTAGACAGAGTGCTGCAGG + Intergenic
929168463 2:38907072-38907094 CTTGGTTGACAGAGAGCAGAGGG + Intronic
930523169 2:52493798-52493820 CTGGGTAAACTGAGGGCTGCAGG - Intergenic
931464845 2:62477015-62477037 CTGGGGAGAGAGAGGGAAGGAGG + Intergenic
932284265 2:70519143-70519165 GTGGGTATTCAGAGGGCAGCAGG + Intronic
932411728 2:71551557-71551579 CAGGGGAGACAGAGGGGAGGAGG - Intronic
932837552 2:75051357-75051379 CTGGGTTGATGTAGGGCAGGAGG + Exonic
933587717 2:84198181-84198203 CTGGGTTGCCAGATGGCAGTTGG + Intergenic
933648478 2:84830837-84830859 CTGAGGAGAAAGAGGGCAGCTGG + Intronic
933846688 2:86332543-86332565 CTGGGGAGAATGAGGGAAGGGGG - Intronic
933943704 2:87266461-87266483 CTGTGTGGACAGTGGGCTGGAGG + Intergenic
934965369 2:98716987-98717009 CTGTGTATACAGAGGGCCGACGG + Intronic
935106013 2:100044428-100044450 TTGGGTAGATAGATGGAAGGGGG - Intronic
935211251 2:100940923-100940945 CAGGGTAGTCAGGGGGCAGGAGG + Intronic
935403762 2:102686841-102686863 CTGAGTATAAAGAGGACAGGAGG + Intronic
935611722 2:105032578-105032600 CTAGGTAGGAAGAGGGGAGGAGG + Intergenic
936153968 2:110036362-110036384 CTGGGAAGACTCAGGGCAGAAGG + Intergenic
936190717 2:110335053-110335075 CTGGGAAGACTCAGGGCAGAAGG - Intergenic
936336516 2:111595118-111595140 CTGTGTGGACAGTGGGCTGGAGG - Intergenic
936376558 2:111946097-111946119 TGGGGAAGACAGAGGGGAGGGGG + Intronic
937467566 2:122148084-122148106 CTGCTTAGACAGAGGCTAGGAGG + Intergenic
937890661 2:126936165-126936187 AAGGGAAGACAGACGGCAGGAGG + Intergenic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
941110487 2:161415212-161415234 CTGGGGAGACAGAGTGGAAGTGG - Intergenic
942426866 2:175869321-175869343 CTGGGAAGCCAGAGGGCAACAGG - Intergenic
942462613 2:176178654-176178676 CTGGGAAGTCCGAGGGCAGGCGG - Intergenic
942958078 2:181797590-181797612 CTGGGTACGCAGGGGACAGGAGG + Intergenic
943501332 2:188693245-188693267 CAGTGTAGACAGGGAGCAGGTGG + Intergenic
943811521 2:192194798-192194820 CTGGGAAGCCGGAGGACAGGAGG + Exonic
944320833 2:198339826-198339848 CTGGGTAGGTGGGGGGCAGGAGG + Intronic
944825032 2:203474157-203474179 CAGGGTAGAAAGAGGGCAAAGGG + Intronic
945928286 2:215828732-215828754 TTTGGAAGACAGAGGGCAGCAGG - Intergenic
946027627 2:216681380-216681402 CTGGATAAAGTGAGGGCAGGTGG + Intronic
946247874 2:218397693-218397715 CTGTAGAGACAGAGGGCAGCTGG + Intergenic
947380581 2:229541293-229541315 CTGGGTAGAAAGGGGGCAATAGG + Intronic
947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG + Intergenic
947706698 2:232282099-232282121 CTGGAAAGACAGAGAGTAGGAGG - Intronic
948566004 2:238886667-238886689 GGGTGGAGACAGAGGGCAGGTGG + Intronic
948599484 2:239100201-239100223 CAGGGAAGGCAGAGGCCAGGAGG - Intronic
948846305 2:240684278-240684300 CTGGGGAGACTGAGACCAGGAGG + Intergenic
948847558 2:240690452-240690474 CTGGGGAGACTGAGACCAGGAGG - Intergenic
948853280 2:240718620-240718642 CTGGGCAGAGTGGGGGCAGGAGG + Intronic
948893906 2:240919480-240919502 CTGGGCACACACAGGACAGGCGG - Intronic
948930752 2:241130431-241130453 CTTGGTGGACAGAGGCCACGTGG - Intronic
1169200546 20:3707083-3707105 CTGGGAAGAATGAGGCCAGGAGG + Exonic
1171342996 20:24445179-24445201 GTGGGTAGGAAGAGGGAAGGGGG - Intergenic
1171519319 20:25764127-25764149 CAGAGGAGACAGAGGGCAGGAGG - Intronic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1172468080 20:35171922-35171944 CGGGGCAGAGGGAGGGCAGGAGG + Intergenic
1172514956 20:35527027-35527049 CTGGGTGGGTAAAGGGCAGGAGG - Exonic
1172611416 20:36255528-36255550 CTGAGAAGACGGAGGGCAGGGGG - Intronic
1172758601 20:37306061-37306083 CTAGGCAGCCAGAGGGCAGTTGG + Intronic
1172759108 20:37309487-37309509 CTGGGAAGACAGACAGCCGGTGG + Intronic
1173294023 20:41739799-41739821 CTGGGTGGAGAGAGGCAAGGAGG - Intergenic
1173654694 20:44691504-44691526 CTGGAAAGACAGAGGGCATGGGG + Intergenic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1173911566 20:46674561-46674583 CAGGGGAGACAGTGGGTAGGTGG + Intronic
1174683797 20:52434194-52434216 CTGTGTAGAAAGAGAGCAGTTGG + Intergenic
1175178443 20:57128014-57128036 CTGGGCAGACAGAAGGGAGCAGG - Intergenic
1175458271 20:59131449-59131471 CTGACTTGACAGAGGGGAGGTGG + Intergenic
1175505798 20:59483307-59483329 CTGGGGAGAAAGTGGGAAGGGGG + Intergenic
1175553745 20:59833159-59833181 CTGGGTAGACACAGCCCCGGAGG - Intronic
1175708238 20:61197285-61197307 CTGGGGAGAGAGAGTGCAGAGGG - Intergenic
1176031414 20:63014812-63014834 CTGTGCTGACTGAGGGCAGGCGG - Intergenic
1176196358 20:63837876-63837898 GTGGGATGACAGGGGGCAGGAGG + Intergenic
1176357860 21:5967278-5967300 CTGCGTGGACAGAGGGCGGAGGG + Intergenic
1176385759 21:6137934-6137956 CTGGGATGGCGGAGGGCAGGTGG + Intergenic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1176705277 21:10112014-10112036 CTGGGTAGAGAAAGGGCAAGAGG + Intergenic
1176841121 21:13844268-13844290 CTGGTTAGGCAACGGGCAGGTGG - Intergenic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1176986460 21:15442964-15442986 ATGGGAAGAGAGGGGGCAGGAGG + Intergenic
1178384391 21:32137688-32137710 CTGAGAAGGCAGAGTGCAGGTGG + Intergenic
1178959597 21:37052713-37052735 CTGGGTAGACACCCGGCAGTGGG - Intergenic
1179277031 21:39901072-39901094 CTGGTTTGACAGAGGACAGCTGG + Intronic
1179737714 21:43400318-43400340 CTGGGATGGCGGAGGGCAGGTGG - Intergenic
1179765658 21:43571273-43571295 CTGCGTGGACAGAGGGCGGAGGG - Intronic
1179928111 21:44549796-44549818 CTGGGTGGGCGGAGGGCCGGTGG - Intronic
1180119348 21:45736525-45736547 CTGGTTAGAGAGACGGCATGGGG + Intronic
1180898845 22:19356707-19356729 CTGGGTAGGCTGAGGGCTGAGGG - Intronic
1181124520 22:20694417-20694439 CTGGGTAGAGACAGGGCCCGTGG - Intergenic
1181167130 22:20989766-20989788 ATGGGGAGACAGGGTGCAGGTGG + Intronic
1181188644 22:21123285-21123307 CTGGGTAGAGACAGGGCCCGTGG + Intergenic
1181210555 22:21287208-21287230 CTGGGTAGAGACAGGGCCCGTGG - Intergenic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181398955 22:22639683-22639705 CTGGGTAGAGACAGGGCCCGTGG + Intergenic
1181501686 22:23319029-23319051 CTGGGTAGAGACAGGGCCCGTGG + Intergenic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181650464 22:24256376-24256398 CTGGGTAGAGACAGGGCCCGTGG - Intergenic
1181706915 22:24654362-24654384 CTGGGTAGAGACAGGGCCCGTGG + Intergenic
1181807806 22:25385585-25385607 CTGGGCTGGGAGAGGGCAGGTGG - Intronic
1182161671 22:28128644-28128666 CTGGGGAGACTGAGGTTAGGAGG - Intronic
1182666361 22:31963192-31963214 TGGGGTAGACACTGGGCAGGTGG + Intergenic
1182801568 22:33035823-33035845 TTTGGTAGACAGAAGGCAGGAGG - Intronic
1184212506 22:43044136-43044158 ATGGCAAGACAGAGGGCAGCGGG - Intronic
1184491752 22:44813984-44814006 CTGGGGAGACACAGCCCAGGAGG - Intronic
1184493862 22:44826033-44826055 CTGTGTACCCGGAGGGCAGGGGG - Intronic
1184667192 22:45995282-45995304 GTGGGGAGACTGAGGCCAGGTGG + Intergenic
1184690081 22:46113572-46113594 CTGGGCAGGCGCAGGGCAGGAGG - Intronic
1184711094 22:46250015-46250037 CTGGGGCGAGAGAGGGCAGGCGG - Intronic
1184744483 22:46448264-46448286 CAGGGAAGACAGAGGGCATGGGG + Intronic
1184795789 22:46731665-46731687 CTGGGGAGGCACAGGGCATGCGG + Intronic
1184817955 22:46886260-46886282 ATGGGAAAACAGAGGCCAGGTGG + Intronic
1185024514 22:48400635-48400657 CTGGGAAGACAGAGCCCAGCCGG - Intergenic
1185341325 22:50292601-50292623 CTGGGAGGACAGAGGCCAGGGGG - Intronic
1203216391 22_KI270731v1_random:8222-8244 CTGGGTAGAGACAGGGCCCGTGG + Intergenic
1203274235 22_KI270734v1_random:77167-77189 CTGGGTAGAGACAGGGCCCGTGG - Intergenic
950434152 3:12968357-12968379 CTGGGTGGAGAAAGGGTAGGGGG - Intronic
951097828 3:18652401-18652423 CATGGTAGACAGAGAGAAGGTGG + Intergenic
952442573 3:33347112-33347134 CTGGGAAGGGTGAGGGCAGGAGG - Intronic
952924454 3:38310871-38310893 CTGGGTATAATGAAGGCAGGAGG - Intronic
952931744 3:38365890-38365912 CTGGGAACACACAGGGCAGCAGG - Intronic
953434876 3:42870536-42870558 CTGGGAAGACAGAGAGCAACAGG - Intronic
953551373 3:43906401-43906423 CAGGGTAGGCAGTGGCCAGGTGG - Intergenic
954100665 3:48370065-48370087 CTGGGTTGATTTAGGGCAGGAGG + Intergenic
954148037 3:48643935-48643957 GTGGGAACACACAGGGCAGGGGG + Intronic
954369589 3:50163242-50163264 TTCGGCAGACAGAGGGCATGGGG - Intronic
954425867 3:50442863-50442885 CTGAGTAGACAAAGGCCTGGAGG - Intronic
954615896 3:51968397-51968419 CCTGGTGGACAAAGGGCAGGGGG + Intronic
955060511 3:55488479-55488501 CTGGAAAGAGAGAGGGAAGGGGG + Intronic
955782835 3:62504594-62504616 CTGGACAGACAGTTGGCAGGAGG - Intronic
960263183 3:115591182-115591204 CGGGATAGCCAGAGGGCAGATGG + Intergenic
960614815 3:119586757-119586779 ATGGGTAGAAAGGGGGCTGGGGG - Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961007351 3:123413845-123413867 CTGGGGAGACAAAGGGGTGGGGG + Intronic
961081992 3:124034612-124034634 CTGTGTAGCCAGGGAGCAGGAGG - Intergenic
961096897 3:124165066-124165088 CTGAGGAGCCAGAGGTCAGGAGG + Intronic
961454194 3:127016174-127016196 CTGGGGAGGCAGAGGCCTGGTGG + Intronic
963066219 3:141266470-141266492 CTGGGCAGATAGAGGACAAGGGG + Intronic
963225842 3:142860840-142860862 CTGGATAGAGGGTGGGCAGGAGG - Intronic
965480412 3:169211969-169211991 ATGGGAAAACAGATGGCAGGTGG - Intronic
965682479 3:171265746-171265768 CTGGGGAAACAGAGGGAAAGTGG + Intronic
966301547 3:178484887-178484909 CTGGATAGCCAGAGGGCAACAGG + Intronic
966509777 3:180748897-180748919 CTGGGCAGGGAGAGGGAAGGAGG + Intronic
967266402 3:187695974-187695996 CTGTGGAGACAGACAGCAGGTGG + Intergenic
967421517 3:189278316-189278338 CTGGGTGGAGAGAGAGCAGCAGG + Intronic
967825934 3:193877353-193877375 CTGGGGAGAAGGTGGGCAGGAGG + Intergenic
968037856 3:195563453-195563475 ATGGGGAGACAGAGGGCAAAAGG - Intergenic
968175414 3:196545156-196545178 CTTGGGAGGCTGAGGGCAGGAGG - Intergenic
968578357 4:1378243-1378265 CCTGGTACACAGAGGGCTGGCGG + Intronic
968909349 4:3469621-3469643 CCGGGTAGACACAGGTCTGGGGG - Intronic
968910658 4:3475615-3475637 CTGGATGGAGAGAGGGCCGGTGG + Intronic
969217021 4:5730965-5730987 GTCGGTGGGCAGAGGGCAGGAGG + Intronic
969307870 4:6336014-6336036 CCGGGTATCCTGAGGGCAGGTGG + Intronic
969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG + Intronic
969469656 4:7380120-7380142 ATGGGTAGACAGAAGCCATGGGG + Intronic
969510541 4:7615061-7615083 ATGGGTAGACAGAGAGATGGTGG - Intronic
969516013 4:7648626-7648648 CTGGGTCTACTGAGGGCGGGCGG + Intronic
969625629 4:8303937-8303959 GTGGGTAGACAGGTGGGAGGAGG - Intronic
969988244 4:11234040-11234062 CTGGGGAGACAGAGGTCATCGGG - Intergenic
970156733 4:13149647-13149669 ATTGGGAGGCAGAGGGCAGGAGG - Intergenic
970477596 4:16439453-16439475 CTGGGAAGACAGAAAGCAGGAGG - Intergenic
971308834 4:25506563-25506585 CTTGTTCGACACAGGGCAGGCGG - Intergenic
972450291 4:39190996-39191018 GTGGGAAGACAGAGAGCTGGAGG - Intronic
973261328 4:48166948-48166970 CTGGGAGGTGAGAGGGCAGGTGG + Intronic
975143385 4:70940297-70940319 CTGGGTAGACAGAGGAAGGTGGG - Intronic
977303332 4:95293686-95293708 CTGGGTACAAAGAAGGGAGGAGG - Intronic
977520367 4:98075158-98075180 CTGGGAAGACAGAAAACAGGAGG - Intronic
980377535 4:131968698-131968720 CTGGGTAGAGAAAGGGCAAGAGG + Intergenic
982837025 4:160131513-160131535 ATGGGTAGAGAGAGGCAAGGTGG - Intergenic
984445240 4:179828439-179828461 CTGGGTTGGCAGAGGTCAAGTGG + Intergenic
984702829 4:182829061-182829083 CTGGGGAGGCAGAGGGGAGGAGG + Intergenic
985477728 5:89216-89238 GTGTGTGGACAGAGGGGAGGAGG - Intergenic
985549518 5:525878-525900 ATAGGTGGACAAAGGGCAGGTGG + Intergenic
985803420 5:2021275-2021297 CTGGAAAGGCAGAGGGCAGAGGG - Intergenic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
985999614 5:3620246-3620268 CTGGGTTCACAGATGGCTGGCGG - Intergenic
986278873 5:6306368-6306390 CTGGGTGGGCCGAGGGGAGGGGG - Intergenic
986325451 5:6669978-6670000 CTGGGCTGACAGAAGGCAGAGGG + Intergenic
986792227 5:11173219-11173241 GTAGGCAGTCAGAGGGCAGGAGG + Intronic
987838819 5:23196738-23196760 CAGGGTTGAAAGAGGGCAAGAGG - Intergenic
990820729 5:59837276-59837298 CTGGCTAGACACTGGACAGGGGG - Intronic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
991925479 5:71701573-71701595 CTGGGTGGCAGGAGGGCAGGAGG + Intergenic
995888582 5:116923422-116923444 CAGGGCAGACAGTGGGAAGGAGG + Intergenic
996423882 5:123291776-123291798 CTAGGAAGACAGAGGGCTGAAGG + Intergenic
996469975 5:123848816-123848838 CTGGGGAGAAAAAGGGGAGGGGG - Intergenic
996862560 5:128083325-128083347 CTGGGTGGAGAGAGGGGAGGTGG + Intergenic
997108935 5:131052549-131052571 TTTGGGAGACTGAGGGCAGGAGG + Intergenic
997786829 5:136721266-136721288 CTAGGCATACATAGGGCAGGTGG + Intergenic
998158955 5:139802288-139802310 CTGGGCAGACAGAAGGGAGGAGG + Intronic
998216029 5:140239316-140239338 CTGGGTAGGCAATGGGCAAGTGG - Intronic
998771589 5:145551948-145551970 ATGGGGAGACAGAAGGCGGGAGG - Intronic
998796565 5:145825998-145826020 CTGGGAAGACAGGAGGCAGATGG + Intronic
999314469 5:150575141-150575163 GTGGCCAGACAGAGAGCAGGGGG - Intergenic
999460850 5:151756795-151756817 CTGTGTAGACGTAGGACAGGTGG - Intronic
999645413 5:153712523-153712545 ATGGGAGGACAGAGAGCAGGAGG - Intronic
1000294097 5:159897938-159897960 CTGGGATGACAGAGGGCTCGGGG + Intergenic
1000620459 5:163479552-163479574 CTTGGGAGGCTGAGGGCAGGAGG + Intronic
1000702251 5:164467076-164467098 GTGGGTAGTCAGCGGGAAGGAGG - Intergenic
1000897182 5:166869191-166869213 CTGGGTAGACAGAGAAGAGAAGG - Intergenic
1001756710 5:174175881-174175903 GTGGGTAAGAAGAGGGCAGGTGG + Intronic
1001847936 5:174938061-174938083 CTGGGGATACAGAGGGGATGAGG - Intergenic
1002426778 5:179181313-179181335 CTGGAGAGGCAGAGGGCAGGGGG - Intronic
1002852587 6:1009907-1009929 CTGTGCAGACAGAGAACAGGTGG - Intergenic
1004360655 6:14967896-14967918 TGGGGTAAACAGAGTGCAGGAGG + Intergenic
1004527623 6:16424135-16424157 TAAGGTAGACAGAGGGCAGGTGG + Intronic
1004577227 6:16909017-16909039 CTGGGCATAGAGAGGGCAAGGGG + Intergenic
1006381506 6:33700598-33700620 CTGGGCAACCAGAGGCCAGGAGG + Intronic
1006574857 6:35037671-35037693 CTGGGTAGACTGAAAGCAAGAGG - Intronic
1006903412 6:37517235-37517257 CTGGAGAGACTGAGGGCAGTCGG + Intergenic
1006941378 6:37754004-37754026 CTGGCCAGAGAGCGGGCAGGGGG + Intergenic
1007150731 6:39688231-39688253 CTGGGAGGCCAGAGGGCAGGAGG + Intronic
1008766588 6:54924592-54924614 CTGAGGAAACACAGGGCAGGTGG - Intronic
1010489059 6:76452550-76452572 CTGCGCTGGCAGAGGGCAGGAGG + Intergenic
1011798473 6:90983067-90983089 AAGGGTAGAAAGAGGGCATGGGG - Intergenic
1012261396 6:97091553-97091575 CTGGGAAGGCATTGGGCAGGTGG - Intronic
1013941266 6:115666182-115666204 CTGGGTAGAAAGGAGGCAGAGGG - Intergenic
1015918335 6:138241290-138241312 CTGGGTAGACAGAGGAGTGATGG - Intronic
1016050771 6:139527809-139527831 CAGGGGTGACAGGGGGCAGGTGG + Intergenic
1016317682 6:142808410-142808432 ATGGGTGGACAGAGGCAAGGAGG + Intronic
1016317704 6:142808506-142808528 ATGAATAGACAGAGGGAAGGAGG + Intronic
1017221759 6:151973595-151973617 AGGGGTAGACAGAGGGCCTGCGG - Intronic
1017914001 6:158818504-158818526 CCCGGGAGAGAGAGGGCAGGGGG + Intronic
1018031389 6:159844669-159844691 TTGGGCAGACTGAGGGCATGAGG + Intergenic
1018205719 6:161435924-161435946 GGGGGAAGACAGAGAGCAGGGGG + Intronic
1018238131 6:161745707-161745729 CTGGGAAGGCAGACGGCAAGGGG + Intronic
1018584456 6:165340803-165340825 CTGCACAGACAGTGGGCAGGGGG + Intronic
1019170861 6:170132463-170132485 CTGGGTACAAAGAGGAAAGGGGG + Intergenic
1020090380 7:5335647-5335669 CTGGGGAGAGAGAGAGCATGGGG - Intronic
1021277850 7:18677104-18677126 CTGAGTATAAAGAGGGCAGGAGG - Intronic
1021777922 7:24072261-24072283 CCAGCTAAACAGAGGGCAGGAGG - Intergenic
1022473371 7:30694999-30695021 CTGGGAAGAGAAAGGGGAGGAGG + Intronic
1022498584 7:30868517-30868539 ATGTATGGACAGAGGGCAGGTGG + Intronic
1023041980 7:36180325-36180347 CTGGGGAGGCAGAGGGGATGAGG + Intronic
1023043770 7:36194491-36194513 CTGGGAAGGAAGGGGGCAGGAGG - Intronic
1023842189 7:44104101-44104123 CTGGGAAGACAGAGGGCCTGAGG - Intergenic
1023896658 7:44439428-44439450 CTGGGCACTCAGAGGGCACGTGG - Intronic
1023937806 7:44751609-44751631 CTGCGGAGACAGAAGGCTGGTGG + Intronic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024499942 7:50093958-50093980 CTGGGTAAAAAGAGGGCAGGTGG - Intronic
1024983873 7:55179533-55179555 CTGGGGAGAAGGTGGGCAGGAGG + Intronic
1025258150 7:57399293-57399315 CTGGGGAGACAGGGGAGAGGAGG + Intergenic
1025279803 7:57619067-57619089 CAGAGGAGACAGAGAGCAGGAGG - Intergenic
1025304929 7:57846434-57846456 CAGAGGAGACAGAGAGCAGGAGG + Intergenic
1025926154 7:65962082-65962104 CTGGGTAGGCAGAGGGCTAGGGG + Intronic
1025973645 7:66352293-66352315 CTCGGTAAACACAGAGCAGGAGG + Intronic
1026875779 7:73878369-73878391 AGGGGTGGACACAGGGCAGGTGG - Intergenic
1026894910 7:74004302-74004324 CTGGGTTAGCAGGGGGCAGGGGG + Intergenic
1027054404 7:75040079-75040101 CTGGGCAGACAGAGCCCAGCTGG + Intronic
1029164214 7:98575168-98575190 CTGGGCTGTCAGAGGGCAGGGGG - Intergenic
1029375442 7:100174460-100174482 ATGGGTCCACAGAGGGGAGGAGG + Intronic
1029692201 7:102189962-102189984 CTGCTGAGCCAGAGGGCAGGGGG - Intronic
1029708717 7:102288123-102288145 CTGGGAGGACTGGGGGCAGGGGG + Intronic
1031483321 7:122303368-122303390 CCGGGCAGAGAGAGGGTAGGAGG + Intronic
1031496184 7:122451051-122451073 CTGGTAATACAGAGAGCAGGAGG + Intronic
1031842287 7:126758512-126758534 CTGGGGAGAAAGAGGACAAGAGG + Intronic
1031973415 7:128079376-128079398 CTGGCTGGCCAGAGGGGAGGAGG - Intronic
1032459563 7:132100498-132100520 AGGGGTAGTGAGAGGGCAGGTGG + Intergenic
1034095535 7:148404699-148404721 CTGGGTACCAAGAGGGCAGGGGG - Intronic
1034627301 7:152503488-152503510 CTGGGTAGGCAGCAGGCAAGAGG + Intergenic
1034748618 7:153547083-153547105 CTGGTGAGACAGAAGGAAGGAGG - Intergenic
1035080915 7:156215359-156215381 CTGGGGTGGCTGAGGGCAGGAGG - Intergenic
1035203653 7:157281361-157281383 CTGCAGAGACAGAGGGCAGATGG + Intergenic
1035623360 8:1051979-1052001 GTGGGTAGAATGTGGGCAGGTGG - Intergenic
1035629183 8:1095324-1095346 CAGGGTCTGCAGAGGGCAGGTGG - Intergenic
1035957686 8:4100381-4100403 CTGACTAGACACAGGGAAGGTGG - Intronic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038113635 8:24528233-24528255 CATGGTAGAAAGAGGGGAGGGGG + Intergenic
1038164382 8:25071154-25071176 CTGGGTAGAAAGAGACCAGAAGG + Intergenic
1038680131 8:29659072-29659094 CTGGGCAGTCTGAGGGCAGCAGG + Intergenic
1040003046 8:42595420-42595442 CTGGGAAGCCAGACGGCAGCAGG - Intergenic
1040512463 8:48107008-48107030 TTTGGGAGACTGAGGGCAGGAGG - Intergenic
1040969248 8:53115600-53115622 CTGGGTGGACAGTGGGCTGGGGG - Intergenic
1041945836 8:63441787-63441809 CATGGTAGACAGAGGGTAAGTGG + Intergenic
1042708156 8:71684294-71684316 CTGGGTTGACAGGGAGCAGGAGG - Intergenic
1044637586 8:94342041-94342063 CTGGGTGGCCTGGGGGCAGGGGG - Intergenic
1044892935 8:96856308-96856330 CTGTGGAGACAGTGGGCAGTGGG + Intronic
1046199875 8:110911143-110911165 CTGGGGATACAGAGGGCGGGGGG + Intergenic
1046714719 8:117554975-117554997 CTGGGGAGACACAGGGCATTGGG - Intergenic
1047136331 8:122082802-122082824 CTGAGTACACAGTAGGCAGGGGG - Intergenic
1047214696 8:122866637-122866659 GTGGGAAGACAGATGGCATGAGG + Intronic
1047255258 8:123209110-123209132 CTGGGGAGCCAGAGGGGAGCAGG + Exonic
1048045647 8:130770304-130770326 CTGGGGAGGGAGAAGGCAGGAGG + Intergenic
1048196598 8:132336615-132336637 TTGGCTAGACAGAGAGGAGGTGG - Intronic
1049023194 8:139971404-139971426 CTGGGCAGGCAGAGGGCAGCTGG - Intronic
1049178309 8:141207115-141207137 CCAGGAAGGCAGAGGGCAGGAGG + Intergenic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049680146 8:143914582-143914604 CTGGGAAGACTTAGGGGAGGAGG - Intergenic
1049726190 8:144147590-144147612 CGGGGCAGACAGAGGGCGGGCGG + Intergenic
1050073605 9:1841292-1841314 CTGGGCAGACAGAGCCCAGCTGG + Intergenic
1052975665 9:34408126-34408148 CTGAGTAGAAGAAGGGCAGGAGG + Intronic
1053014676 9:34655041-34655063 CTGGGTATACAGTGGGAAAGGGG + Intronic
1053642554 9:40099114-40099136 CTGGGTAGAGAAAAGGCAAGAGG + Intergenic
1053763598 9:41366379-41366401 CTGGGTAGAGAAAAGGCAAGAGG - Intergenic
1054323412 9:63696386-63696408 CTGGGTAGAGAAAGGGCAAGAGG + Intergenic
1054542206 9:66277518-66277540 CTGGGTAGAGAAAAGGCAAGAGG - Intergenic
1055130246 9:72766593-72766615 CTGTGTAGGCAGGAGGCAGGGGG + Intronic
1057220696 9:93256330-93256352 CTGGAGGGACGGAGGGCAGGCGG - Exonic
1057855124 9:98595757-98595779 CTGGATAGACAGGAGGCTGGAGG + Intronic
1057968478 9:99529542-99529564 CAGGGTAGAAATAGGGCTGGTGG - Intergenic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1060202628 9:121660521-121660543 GGGGGAAGGCAGAGGGCAGGTGG + Intronic
1060374413 9:123105803-123105825 CAGATTAGACAGAGAGCAGGTGG + Intergenic
1060398819 9:123335500-123335522 CTGTGAGGGCAGAGGGCAGGTGG - Intergenic
1061238050 9:129353308-129353330 CTGGGGAGTCACAGGGAAGGTGG + Intergenic
1061500453 9:130998556-130998578 CTGGGAAGGCAGAAGGCACGAGG + Intergenic
1061613445 9:131763624-131763646 ATGGGCAGACAGAGGGCAGAGGG + Intergenic
1061828234 9:133274991-133275013 CTGGGGAGCCGGCGGGCAGGTGG - Intronic
1061970233 9:134040985-134041007 CAAGGAAGACAGAGGGCGGGTGG + Intronic
1062144345 9:134980625-134980647 CTGGGTGGCCGGGGGGCAGGTGG + Intergenic
1062178713 9:135179191-135179213 CTGGCCACACAGAGGTCAGGAGG + Intergenic
1062278948 9:135743540-135743562 CTGGGAAGATAGAGGTCCGGTGG - Intronic
1062397398 9:136357991-136358013 CTGGGTGGACACAGTGCAGTTGG - Intronic
1062582232 9:137233806-137233828 GTGGGCAGACAGAGGTCAGAGGG - Intronic
1202790308 9_KI270719v1_random:82110-82132 CTGGGTAGAGAAAGGGCAAGAGG + Intergenic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1185745485 X:2569408-2569430 CTGGGTAGACTGAGAGTCGGTGG - Intergenic
1185791008 X:2928481-2928503 CTGGGAAGGCAAAGGGCCGGGGG + Intronic
1187571025 X:20502301-20502323 CTGGGTGGGCTGAGGGGAGGTGG - Intergenic
1189201053 X:39195885-39195907 CTGGTTGGACAGAGAGTAGGAGG - Intergenic
1190772923 X:53529952-53529974 AGGGGTAGACAGAGGGGATGTGG - Intergenic
1191861818 X:65671740-65671762 CTGGGTAGGGAGGGGGCTGGTGG + Intronic
1195917893 X:109953764-109953786 CTGGGTTGAAAGAGAGCAGGTGG - Intergenic
1196031509 X:111098638-111098660 CTGGGTAAGGAGAGGGCAGTGGG + Intronic
1198715205 X:139551303-139551325 CTGGCAAGACACAGGCCAGGTGG + Intronic
1199709793 X:150461022-150461044 CCAGGTAGCCAGAGGCCAGGTGG + Intronic
1199943444 X:152647291-152647313 CTGGGTAGAACGAGTGAAGGGGG - Intronic
1200056494 X:153464101-153464123 CAGGCTTGTCAGAGGGCAGGTGG - Intronic
1201352955 Y:13066473-13066495 CTGGGTAGACAGCTAGCAGTGGG - Intergenic
1201383535 Y:13413330-13413352 CGGTGTGGATAGAGGGCAGGAGG - Intronic
1201629185 Y:16050617-16050639 ATGGATAGATAGAGAGCAGGTGG + Intergenic