ID: 1049404307

View in Genome Browser
Species Human (GRCh38)
Location 8:142444906-142444928
Sequence GTGCAGATGTTGAGGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049404307_1049404326 24 Left 1049404307 8:142444906-142444928 CCATCCTTCCTCAACATCTGCAC No data
Right 1049404326 8:142444953-142444975 CTGGGGGTGGGAGGGGGGCCAGG No data
1049404307_1049404316 7 Left 1049404307 8:142444906-142444928 CCATCCTTCCTCAACATCTGCAC No data
Right 1049404316 8:142444936-142444958 GGCACCTTCAGGCTGAGCTGGGG No data
1049404307_1049404323 17 Left 1049404307 8:142444906-142444928 CCATCCTTCCTCAACATCTGCAC No data
Right 1049404323 8:142444946-142444968 GGCTGAGCTGGGGGTGGGAGGGG No data
1049404307_1049404320 12 Left 1049404307 8:142444906-142444928 CCATCCTTCCTCAACATCTGCAC No data
Right 1049404320 8:142444941-142444963 CTTCAGGCTGAGCTGGGGGTGGG No data
1049404307_1049404315 6 Left 1049404307 8:142444906-142444928 CCATCCTTCCTCAACATCTGCAC No data
Right 1049404315 8:142444935-142444957 GGGCACCTTCAGGCTGAGCTGGG No data
1049404307_1049404317 8 Left 1049404307 8:142444906-142444928 CCATCCTTCCTCAACATCTGCAC No data
Right 1049404317 8:142444937-142444959 GCACCTTCAGGCTGAGCTGGGGG No data
1049404307_1049404313 -4 Left 1049404307 8:142444906-142444928 CCATCCTTCCTCAACATCTGCAC No data
Right 1049404313 8:142444925-142444947 GCACAGTTTGGGGCACCTTCAGG No data
1049404307_1049404321 15 Left 1049404307 8:142444906-142444928 CCATCCTTCCTCAACATCTGCAC No data
Right 1049404321 8:142444944-142444966 CAGGCTGAGCTGGGGGTGGGAGG No data
1049404307_1049404325 19 Left 1049404307 8:142444906-142444928 CCATCCTTCCTCAACATCTGCAC No data
Right 1049404325 8:142444948-142444970 CTGAGCTGGGGGTGGGAGGGGGG No data
1049404307_1049404319 11 Left 1049404307 8:142444906-142444928 CCATCCTTCCTCAACATCTGCAC No data
Right 1049404319 8:142444940-142444962 CCTTCAGGCTGAGCTGGGGGTGG No data
1049404307_1049404324 18 Left 1049404307 8:142444906-142444928 CCATCCTTCCTCAACATCTGCAC No data
Right 1049404324 8:142444947-142444969 GCTGAGCTGGGGGTGGGAGGGGG No data
1049404307_1049404314 5 Left 1049404307 8:142444906-142444928 CCATCCTTCCTCAACATCTGCAC No data
Right 1049404314 8:142444934-142444956 GGGGCACCTTCAGGCTGAGCTGG No data
1049404307_1049404322 16 Left 1049404307 8:142444906-142444928 CCATCCTTCCTCAACATCTGCAC No data
Right 1049404322 8:142444945-142444967 AGGCTGAGCTGGGGGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049404307 Original CRISPR GTGCAGATGTTGAGGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr