ID: 1049405168

View in Genome Browser
Species Human (GRCh38)
Location 8:142449163-142449185
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049405168_1049405175 14 Left 1049405168 8:142449163-142449185 CCTCCATTCATCTGTGTGTCCGT No data
Right 1049405175 8:142449200-142449222 TCCATCATCCAGCCAGCCAGTGG No data
1049405168_1049405177 15 Left 1049405168 8:142449163-142449185 CCTCCATTCATCTGTGTGTCCGT No data
Right 1049405177 8:142449201-142449223 CCATCATCCAGCCAGCCAGTGGG No data
1049405168_1049405178 16 Left 1049405168 8:142449163-142449185 CCTCCATTCATCTGTGTGTCCGT No data
Right 1049405178 8:142449202-142449224 CATCATCCAGCCAGCCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049405168 Original CRISPR ACGGACACACAGATGAATGG AGG (reversed) Intergenic
No off target data available for this crispr