ID: 1049406176

View in Genome Browser
Species Human (GRCh38)
Location 8:142452746-142452768
Sequence GGGGCGGAGGACGCCGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 298}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049406176_1049406195 14 Left 1049406176 8:142452746-142452768 CCTCCTGCGGCGTCCTCCGCCCC 0: 1
1: 0
2: 3
3: 25
4: 298
Right 1049406195 8:142452783-142452805 CCGCCTCCGGGAGTGGGTCGTGG No data
1049406176_1049406189 7 Left 1049406176 8:142452746-142452768 CCTCCTGCGGCGTCCTCCGCCCC 0: 1
1: 0
2: 3
3: 25
4: 298
Right 1049406189 8:142452776-142452798 CCCGACCCCGCCTCCGGGAGTGG No data
1049406176_1049406197 16 Left 1049406176 8:142452746-142452768 CCTCCTGCGGCGTCCTCCGCCCC 0: 1
1: 0
2: 3
3: 25
4: 298
Right 1049406197 8:142452785-142452807 GCCTCCGGGAGTGGGTCGTGGGG No data
1049406176_1049406200 21 Left 1049406176 8:142452746-142452768 CCTCCTGCGGCGTCCTCCGCCCC 0: 1
1: 0
2: 3
3: 25
4: 298
Right 1049406200 8:142452790-142452812 CGGGAGTGGGTCGTGGGGCGCGG No data
1049406176_1049406186 1 Left 1049406176 8:142452746-142452768 CCTCCTGCGGCGTCCTCCGCCCC 0: 1
1: 0
2: 3
3: 25
4: 298
Right 1049406186 8:142452770-142452792 GGTCGGCCCGACCCCGCCTCCGG No data
1049406176_1049406187 2 Left 1049406176 8:142452746-142452768 CCTCCTGCGGCGTCCTCCGCCCC 0: 1
1: 0
2: 3
3: 25
4: 298
Right 1049406187 8:142452771-142452793 GTCGGCCCGACCCCGCCTCCGGG No data
1049406176_1049406191 8 Left 1049406176 8:142452746-142452768 CCTCCTGCGGCGTCCTCCGCCCC 0: 1
1: 0
2: 3
3: 25
4: 298
Right 1049406191 8:142452777-142452799 CCGACCCCGCCTCCGGGAGTGGG No data
1049406176_1049406196 15 Left 1049406176 8:142452746-142452768 CCTCCTGCGGCGTCCTCCGCCCC 0: 1
1: 0
2: 3
3: 25
4: 298
Right 1049406196 8:142452784-142452806 CGCCTCCGGGAGTGGGTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049406176 Original CRISPR GGGGCGGAGGACGCCGCAGG AGG (reversed) Intronic
900786692 1:4654438-4654460 GGGGCCGGGGTCGCCGCGGGTGG - Intergenic
901295164 1:8155784-8155806 GGGGAGGAGGGGGACGCAGGAGG + Intergenic
901332749 1:8423677-8423699 AGGGCGGAGGCGGCCGCGGGTGG + Intronic
901631813 1:10651660-10651682 TGGGCGGGTGAGGCCGCAGGAGG + Intronic
901852767 1:12026522-12026544 GGGGCGGAGCACGCTGGAGCAGG - Intronic
903179879 1:21599778-21599800 GGGTAGGAGGAGGCTGCAGGGGG - Intronic
903282383 1:22257396-22257418 GGGGAGGAGGAAGGGGCAGGGGG - Intergenic
905016403 1:34781637-34781659 GGCGCGGAGGAGGGAGCAGGAGG - Exonic
905105902 1:35563445-35563467 GTGGGGGAGGAGGCCGGAGGAGG + Intronic
905282987 1:36860767-36860789 GCGGCAGAGGACGTGGCAGGTGG + Intronic
905684819 1:39901049-39901071 GGGGCGGCGGACGCCTTGGGCGG + Exonic
906295296 1:44645742-44645764 CGGGCGAAGGCCGCCGCAGCAGG - Intronic
907278149 1:53328160-53328182 GGGGCGGAGGCGGCAGCGGGAGG - Intergenic
907364173 1:53945981-53946003 GGGGCCGAGGCCGCCGCGAGGGG - Intergenic
907430043 1:54406328-54406350 GGCGCAGAGGGCGGCGCAGGCGG - Exonic
910221469 1:84893134-84893156 GCAGCGGAGGACGCGGCGGGCGG + Intronic
913129652 1:115828316-115828338 GCGGACGCGGACGCCGCAGGTGG - Intergenic
913450212 1:118987947-118987969 AGGGCGGAGGAGGACGCAGGGGG - Intronic
915162976 1:153932765-153932787 GGGGCTGGGGACACTGCAGGGGG + Exonic
915282101 1:154829699-154829721 GGGGCTGAGGAGGGCACAGGAGG - Intronic
915314183 1:155018632-155018654 GTGGCGGAGGATGTCTCAGGTGG + Exonic
915564383 1:156705676-156705698 GGGGCGCAGGGCCCCCCAGGTGG - Intronic
918400835 1:184161351-184161373 TGGGAGGAGGAGGCTGCAGGGGG + Intergenic
920367814 1:205457249-205457271 GTGGCTGAGGACGCCGTCGGCGG + Intergenic
920412727 1:205774901-205774923 GTGGTGGGGGACGCCGCAGTGGG - Exonic
922516802 1:226214050-226214072 GGGGTGGAGGATGACCCAGGCGG - Intergenic
1064415751 10:15148264-15148286 GGGACGGAGGACAAGGCAGGAGG + Intronic
1064671031 10:17713961-17713983 GCGGCAGAGGGGGCCGCAGGGGG - Intronic
1067711576 10:48655268-48655290 GGGGCGGGGGACGCTGCATCAGG + Intronic
1067828691 10:49597628-49597650 GGGCCTGAGGACCCTGCAGGAGG - Intergenic
1069422823 10:68261731-68261753 GTGGGGCAGGACGCCGGAGGCGG + Intergenic
1069856296 10:71442950-71442972 GGGGCGGAGGGCGAGGCAGAGGG + Intronic
1073137266 10:101227047-101227069 GGGGCGGCGGAGGCCGCTGGTGG + Exonic
1073207382 10:101776190-101776212 GGGGCGGGGGGCGCCGCACCGGG + Intronic
1074618657 10:115094109-115094131 GGGGCGGGGGAGGCCGCGAGGGG - Intronic
1075649243 10:124116906-124116928 GAGGAGGAGGAGGCCGCAGTGGG + Intergenic
1076035588 10:127196445-127196467 GGGGCAGAGGAGGGAGCAGGAGG + Intronic
1076189973 10:128475989-128476011 GGGTCAGACGACACCGCAGGGGG - Intergenic
1076782101 10:132730165-132730187 GGGGCTGAGGACAGGGCAGGTGG - Intronic
1076903498 10:133351264-133351286 GGGGTGGAGGTGGCTGCAGGGGG - Intronic
1077010062 11:375700-375722 GGGGGGGCGTCCGCCGCAGGAGG + Exonic
1077190101 11:1252447-1252469 GGGGCGGAGGACACTGGCGGTGG - Exonic
1077253756 11:1571814-1571836 GGGGCGGAGGGCGCCGCGTCGGG - Intronic
1077460804 11:2708464-2708486 GGGGCTGAGGAGGCTGGAGGTGG + Intronic
1077554631 11:3220137-3220159 GGGTCGGAGGAAGCTGCAGGGGG - Intergenic
1077975433 11:7243468-7243490 GGGGAGGAGGAGGCAGAAGGGGG - Intronic
1078452792 11:11452890-11452912 GGGGCTGAGGACTCCCCAGGAGG + Intronic
1083207467 11:61161324-61161346 GGGGCAGAGGACGACGGTGGGGG - Intronic
1083713396 11:64562215-64562237 GGGGCTCAGGCCGCCGCATGAGG + Intronic
1083857427 11:65400062-65400084 GGGGCAGGGGAGGCCGCAGCTGG + Intronic
1083968052 11:66055117-66055139 GTGGCGGAGGAGGCTGCAGAGGG - Exonic
1084516581 11:69641028-69641050 GGGGCGGGGGCGGGCGCAGGGGG - Intergenic
1084553689 11:69863834-69863856 GGGAAGGAGGAAGCCTCAGGGGG - Intergenic
1085300978 11:75458054-75458076 GGGGCGGGGGAACCCACAGGAGG - Intronic
1085561234 11:77474142-77474164 GGGGAGGAGGAGGCGGGAGGAGG - Intronic
1089256934 11:117199116-117199138 GGGGCGGGGCACGCTGCCGGCGG - Intergenic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1090003218 11:122979540-122979562 GGGGCGGAGGAAGGCACTGGGGG - Intronic
1090703547 11:129316546-129316568 GGGGAGGTGGAGGCCCCAGGGGG - Intergenic
1091280147 11:134377068-134377090 GGGGCAGAAGACCCTGCAGGTGG - Intronic
1091558677 12:1594443-1594465 GAGGCGGAGGATGCGGCAGGGGG - Intronic
1092108915 12:5945330-5945352 GGGGAGGAGGAGGCGGCAGCCGG - Intronic
1092204420 12:6606758-6606780 GGGCCAGGGGAGGCCGCAGGCGG + Intronic
1096396551 12:51270373-51270395 CGAGCGGAGGAAGCCGCGGGTGG + Exonic
1096814923 12:54196010-54196032 GGGGAGGAGGACGCGGGCGGGGG - Intergenic
1097046123 12:56189119-56189141 GGGGCAGAGGGCGCAGCAGTGGG + Intronic
1097057479 12:56258471-56258493 GGGGCGGAGGGCGCTGCGGCCGG - Intergenic
1098925841 12:76348675-76348697 GGGGCAGCGGACGCCACTGGAGG - Intergenic
1102645825 12:114403261-114403283 GGCGCGGAGGAGGCAGGAGGAGG + Intronic
1105492613 13:20902945-20902967 GGGGCGGGGGCGGCCGCAGCCGG + Intronic
1107123396 13:36819398-36819420 GGGGTGGGGCACGCCGCTGGCGG - Exonic
1108063160 13:46553026-46553048 GGCGCGGAGGAAGGCTCAGGCGG + Intergenic
1108689926 13:52850870-52850892 CGGGCGGAGGACCCGGAAGGTGG + Intergenic
1112402140 13:99086552-99086574 GGGGCCGCGGACGCCGAGGGGGG - Intronic
1113398856 13:109973445-109973467 GGGGCGGGGGGCGCTGCAGCTGG - Intergenic
1113565171 13:111315547-111315569 GGGCTGGGGGAGGCCGCAGGCGG - Intergenic
1113909780 13:113836475-113836497 GAGGGGGAGGACGACGGAGGGGG + Intronic
1114120701 14:19668500-19668522 GGCGCAGAGGGCGGCGCAGGCGG + Intergenic
1114551524 14:23535183-23535205 GAGGTGGAGGAGGCAGCAGGGGG + Exonic
1117176767 14:53153343-53153365 GGGGCGGCGCACGCGGCCGGGGG - Intergenic
1119441466 14:74631374-74631396 GGGAGGGAGGAGGCCCCAGGGGG + Intergenic
1121093969 14:91202872-91202894 GGGGCGGCGGGGGCCACAGGAGG - Intronic
1122688560 14:103521222-103521244 GGGAGGGAGGACGCCGCGAGAGG + Intronic
1123824677 15:24069209-24069231 GGGGAGCAAGACGCCGAAGGTGG - Intergenic
1124109499 15:26773072-26773094 GGAGCGGAGGAGGGCGGAGGGGG + Exonic
1128582326 15:68818733-68818755 GGGGCCGGGGTCGCCGCGGGTGG - Intronic
1131193989 15:90340513-90340535 GAGGTGGAGGAGGCTGCAGGTGG - Intergenic
1132475952 16:138289-138311 GGGGCGGAGGGGGCCAGAGGAGG + Exonic
1132520257 16:383984-384006 GGGGCTGAGGACGGCCCAGCTGG - Intronic
1132553329 16:562120-562142 GGGGCGGTGGACAGCCCAGGTGG + Intronic
1132626770 16:895039-895061 AGGGCTGAGGAGGCCGCGGGGGG + Intronic
1132894800 16:2223726-2223748 GAGGCCGAGGAAGCCGCTGGGGG - Exonic
1132915199 16:2340372-2340394 GGAGCCGAGGCCGCGGCAGGAGG + Intronic
1133443242 16:5837883-5837905 GGGGCAGAGGACCCCGTGGGAGG + Intergenic
1134070271 16:11256087-11256109 GGGGCGCGGGACGCCGCGGGCGG + Exonic
1134244062 16:12526783-12526805 TGGGCTGTGGACCCCGCAGGGGG - Intronic
1135923523 16:26672401-26672423 GGGGTGGGGGAAGCCACAGGGGG - Intergenic
1136666698 16:31819280-31819302 GAGCCTGAGGACGCCGCTGGGGG - Intergenic
1137655376 16:50154015-50154037 GGGGACGAGGACGCCGAGGGAGG - Exonic
1138104997 16:54283123-54283145 GGGGCTGGGGGCGCCGCAGCAGG - Intergenic
1139754484 16:69132111-69132133 CGGGCGGAGGACGGAGAAGGGGG - Intronic
1139952818 16:70680260-70680282 AGAGGGGAGGCCGCCGCAGGAGG - Intronic
1141132354 16:81444938-81444960 GGGGCGGGGGAGGCCGAGGGCGG - Intergenic
1141697759 16:85628155-85628177 GGGGCGGGGGCCGCAGCAGCCGG - Intronic
1142156573 16:88535091-88535113 TCGGCGGAGGGGGCCGCAGGGGG + Exonic
1142237143 16:88927701-88927723 GGGGAGGAGGAGGCGGAAGGGGG - Intronic
1142878065 17:2864264-2864286 GGTGCTGAGGACGCAGCAGTGGG + Intronic
1142891880 17:2949013-2949035 GGGGAGGAGGATGCTGGAGGAGG - Intronic
1143082795 17:4394116-4394138 GGGGAGGAGGCTGCAGCAGGTGG + Intergenic
1143481181 17:7228077-7228099 GGGGAAGAGGAGGCCTCAGGAGG + Intronic
1144346383 17:14353528-14353550 GGGGTGGAGGACGGCTCTGGAGG + Intergenic
1145941222 17:28744293-28744315 GGGGCGGGGGGCGCCGCCTGGGG + Intronic
1146912503 17:36657831-36657853 GGGGCGGAGGACGCAGCGGGCGG + Intergenic
1147648886 17:42050730-42050752 TGGGCGGGAGGCGCCGCAGGTGG - Intronic
1148108668 17:45132536-45132558 GAGTCGGAGGAGGCAGCAGGAGG + Intronic
1148437279 17:47694267-47694289 GGGCAGGAGGAGGCGGCAGGAGG + Intronic
1149604583 17:57915821-57915843 GGGGAGGAGGGGGCCTCAGGGGG + Intronic
1151147364 17:72053601-72053623 GGGGCGGAGGACAGAGAAGGGGG - Intergenic
1151960383 17:77402565-77402587 GGGGCGGTGGGCGCCTCAGCAGG - Exonic
1152026366 17:77811999-77812021 GGGGAGGAGGACATCTCAGGAGG - Intergenic
1152197265 17:78925108-78925130 CGGGCGGGGGCCGCCGCTGGGGG + Exonic
1152549146 17:81020762-81020784 GGGCCGAAGGAGGCCCCAGGAGG + Intergenic
1152919265 17:83057690-83057712 GGGGCGGAAGACGTCTCATGGGG + Intergenic
1152923984 17:83079410-83079432 GGGGCGGGGGGCGCTGCAGGAGG - Intergenic
1153335272 18:3917319-3917341 GGGGCTGAGGACCCTGCAGACGG + Intronic
1154490323 18:14917127-14917149 GGGCCGGAGGACGCAGCCAGGGG - Intergenic
1154954608 18:21242167-21242189 GAGGCGGCGGCCGCCGCAGCCGG - Intergenic
1156452984 18:37277103-37277125 GGGCAGGAGGACTCTGCAGGTGG - Intronic
1157224797 18:45853018-45853040 GGTGGGGAGGACCCCACAGGTGG - Intronic
1160454880 18:78993091-78993113 GGGGAAGATGACGCCGCTGGCGG - Exonic
1160831927 19:1108287-1108309 GGGGCGGGGGGCGCGGCGGGCGG - Exonic
1160927867 19:1555738-1555760 GGGGCCGAGGACGCCGAAGGGGG + Exonic
1160930625 19:1568109-1568131 GAGGCGGAGGGCGGCGCGGGCGG - Intergenic
1160955899 19:1691614-1691636 GGGACAGAGGACACGGCAGGTGG - Intergenic
1161153400 19:2720954-2720976 GGGGCGGAGGGCGAAGAAGGCGG + Intronic
1161168341 19:2800580-2800602 TGGCCGGAGGCCTCCGCAGGTGG + Intronic
1161220638 19:3116519-3116541 GGCGGGGAGGACGCTGCATGAGG - Intronic
1161288982 19:3482916-3482938 GGCGAGGAGGACGCCGGCGGGGG - Intergenic
1161435100 19:4258382-4258404 GCGGCGGAGGCAGCAGCAGGAGG + Exonic
1161438726 19:4279093-4279115 GGGGCCGAGGCCGCGGCAGCTGG - Exonic
1161438780 19:4279224-4279246 GGGGCGGGGGACGCGGCGGAGGG + Exonic
1161820940 19:6531164-6531186 GGCGAGGAAGACGGCGCAGGCGG - Exonic
1161961814 19:7527539-7527561 GGGGCGGAGGGGGCCGCTCGGGG - Exonic
1162396639 19:10421063-10421085 CGGGCGGAGGCAGCAGCAGGCGG + Exonic
1163632498 19:18424564-18424586 GGGGCGGGGGGCGGCACAGGAGG + Intronic
1165096095 19:33410676-33410698 GGGGCAGAGGGCTCTGCAGGAGG + Intronic
1165490692 19:36121222-36121244 GGGCCGGAGGAGGGCGGAGGAGG + Intronic
1166984077 19:46649344-46649366 GGGGCGGCGGGCGGCGCAGCGGG + Exonic
1167285441 19:48596468-48596490 GGGGCAGAGGTCACAGCAGGGGG - Intronic
1167285446 19:48596487-48596509 GGGGCAGAGGTCACAGCAGGGGG - Intronic
1167293656 19:48637385-48637407 GGGGCGGAGGAGGGGGCAGGAGG + Exonic
1167457032 19:49601721-49601743 GGGGCGGCGGGCTCCTCAGGAGG - Exonic
1168072000 19:53958577-53958599 GGGGCTGGGGACGCGGGAGGGGG + Intergenic
1168246912 19:55117148-55117170 GGGAAGGAGGATGCCCCAGGTGG + Intronic
1168265811 19:55223523-55223545 GGGGAGTAGGAGGCCTCAGGAGG - Intergenic
1168455910 19:56508083-56508105 GGGGCGGAGGCCGCGGCTCGGGG + Intronic
925185257 2:1842597-1842619 GGGGCGGAGGAGGCCAAGGGAGG - Intronic
925959772 2:9003798-9003820 GGGGCGGCGGGCGCGGGAGGAGG - Exonic
927115969 2:19902189-19902211 GGGGCCGATGACGCTGGAGGTGG + Intergenic
927441873 2:23124576-23124598 GGGGAGGAGGACTAGGCAGGTGG + Intergenic
929531147 2:42753689-42753711 GGGGCGCAGGGCGCTGCAGAAGG - Exonic
929897763 2:45976469-45976491 GCGGCCGAGGAAGCGGCAGGGGG + Exonic
934624636 2:95836055-95836077 GGGGTGGTGGAGGCCCCAGGTGG + Intergenic
934808945 2:97265365-97265387 GGGGTGGTGGAGGCCCCAGGTGG - Intergenic
934828560 2:97491804-97491826 GGGGTGGTGGAGGCCCCAGGTGG + Intergenic
935592490 2:104855393-104855415 GGGGGGGAGGAGGCGGGAGGCGG + Intergenic
937891236 2:126940499-126940521 GGGGCGGGGCAGGCCACAGGTGG + Intergenic
938056621 2:128220283-128220305 GGGGCGCAGGATGCTGGAGGTGG + Intergenic
942278743 2:174340984-174341006 GGGGCGGGGGACGCGGCCTGGGG + Intergenic
942748703 2:179264576-179264598 GAGGCGGAGGGCGCGGCGGGAGG + Exonic
943060606 2:183038353-183038375 GGGGCGGAGAGCGCCGGGGGTGG - Exonic
947549566 2:231037085-231037107 GGGGCGGAGGGCGCAGAAGTGGG - Intergenic
947600034 2:231441511-231441533 GGGGAGGAGGCCGAGGCAGGAGG - Intergenic
947625439 2:231615430-231615452 TGGGAGGAGGACGAAGCAGGAGG + Intergenic
947650294 2:231780973-231780995 GGGGCGGGGGCCGCGCCAGGTGG - Intronic
947720750 2:232367999-232368021 AGGGCAGAGGGCACCGCAGGAGG - Intergenic
948359798 2:237412226-237412248 GGGGTGGAGGGCGCTGAAGGAGG - Intronic
948513222 2:238487253-238487275 GGGGCTGAGGAGGCTGCAGGGGG - Intergenic
948801750 2:240436303-240436325 GGGGCGGAGGACGACCGAGCGGG - Intronic
948868065 2:240785288-240785310 GGGGCTGAGGACGCCACTGTGGG - Intronic
949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG + Intergenic
1169211673 20:3769159-3769181 GAGGCGGAGGAGGCAGGAGGGGG - Intergenic
1172284648 20:33732149-33732171 GGGGCGGAGGGCGCCGGGGCTGG + Intronic
1172444135 20:34984448-34984470 GGGGCAGAGGAGGCTGCAGGTGG + Intronic
1172731953 20:37095876-37095898 GCGGCGGTGGTCGCCGCAGCCGG - Exonic
1174804179 20:53592706-53592728 GAGGCGGAGGGCGCTGCTGGGGG - Intronic
1175237677 20:57525497-57525519 AGGGAGGAGGGCCCCGCAGGGGG + Intronic
1175472438 20:59240191-59240213 GGGGTGGAGAATGCCGCAGGAGG - Intronic
1175834522 20:61984993-61985015 GGGAGGGAGGGCGCAGCAGGAGG + Intronic
1175910622 20:62403634-62403656 GGCGGGGAGGAGGCTGCAGGCGG + Intronic
1176237971 20:64063101-64063123 GGCGCGGCGGGCGCGGCAGGCGG + Intronic
1179525478 21:41973414-41973436 CGGGCGGATGAAGCCTCAGGCGG - Intergenic
1179590761 21:42406329-42406351 GGGGAGGAAGACGGCGGAGGAGG + Exonic
1180560105 22:16609142-16609164 GGGGCGGAGGGCGCTGCTGGGGG - Intergenic
1181068802 22:20320084-20320106 GGGGCGGAGCGCGCCGCGCGTGG - Intergenic
1181278614 22:21703033-21703055 GAGGCCGAGGAGGCTGCAGGGGG - Intronic
1182043847 22:27259297-27259319 GGGGTGGAGGAACGCGCAGGAGG - Intergenic
1183535201 22:38397386-38397408 GGGGCGGAGGGCGCTGCTGGGGG - Intronic
1183736634 22:39648252-39648274 GGCTCGGAGGAGGCCCCAGGTGG + Intronic
1184660218 22:45962180-45962202 AGGGCTGAGGCCGCTGCAGGTGG + Intronic
1184805701 22:46793708-46793730 GGGGCGGCCCACGCTGCAGGAGG + Exonic
1184888742 22:47366627-47366649 GGGCCAGAGGACGGAGCAGGTGG + Intergenic
1185335789 22:50270369-50270391 GGAGCGGAGGGCGGCGGAGGCGG + Exonic
949281868 3:2355594-2355616 GGGTTGGAGGAGGGCGCAGGAGG - Intronic
953545084 3:43858369-43858391 GGGGCTGCGGAGGCAGCAGGGGG - Intergenic
953705370 3:45226332-45226354 GGGGCGGGGCACGCGGGAGGCGG - Intergenic
959875088 3:111373148-111373170 GGGGTAGAGGAAGCAGCAGGAGG + Intronic
961352317 3:126311762-126311784 TGGGCAGAGGACGGCTCAGGGGG - Intergenic
961754840 3:129121638-129121660 GGGGCCGAGGCCGAGGCAGGCGG - Exonic
962809009 3:138946199-138946221 GGGGCCGGAGGCGCCGCAGGCGG - Exonic
966977326 3:185096597-185096619 GGTGCGGAGGACTCTGCAGGAGG + Intronic
967390200 3:188947797-188947819 GGTGGGGAGGAGGCTGCAGGAGG - Intronic
967849556 3:194071426-194071448 GGGGCGGAGGGGGACGCAGAGGG + Intergenic
968515068 4:1012325-1012347 CAGGCGGAGGAAGCCGCAGCGGG - Intronic
968551621 4:1226346-1226368 GGGGAGGAGGAGGGGGCAGGAGG + Intronic
968584596 4:1410275-1410297 CGGGCGGAGGACGGGGAAGGAGG + Intergenic
968977712 4:3830597-3830619 GGAGCAGAGGATGCCACAGGGGG + Intergenic
969591782 4:8126321-8126343 GGGGAGGAGGGAGCCGCTGGAGG + Intronic
969608774 4:8215789-8215811 GGGGCCGTGCAGGCCGCAGGGGG - Intronic
970205752 4:13654274-13654296 GCGCCGGAGGACACCGCAGCTGG + Intergenic
971019075 4:22516115-22516137 GGGGCGGGGGCGGCCGCCGGCGG - Intergenic
971405592 4:26319392-26319414 GGGGCGGAGGGCGGCGGGGGAGG - Intronic
976246737 4:83012621-83012643 GGCGCGGCGGACCCCGCTGGCGG + Intronic
977788270 4:101066752-101066774 GGGGCGGAGGATGTGGGAGGTGG - Intronic
986006927 5:3676449-3676471 GGGTTGGAGGACATCGCAGGGGG + Intergenic
986357169 5:6940083-6940105 GTGGGGGAGGACCCAGCAGGAGG + Intergenic
986721477 5:10563980-10564002 GGGGCGGAGGTGGCGGCGGGGGG - Intergenic
986868381 5:12016549-12016571 GAGGCGGAGGTCTCAGCAGGAGG - Intergenic
992090624 5:73312874-73312896 GGGGAGGAGGAGGAGGCAGGAGG - Intergenic
992443976 5:76818628-76818650 GGTGCGGTGGACCCTGCAGGAGG - Intergenic
992473140 5:77077359-77077381 GAGGCGGAGGGCGCTGCAGGAGG - Exonic
992515857 5:77491995-77492017 GGGGCGGAGGGCGCGGGAGCCGG - Intronic
992950438 5:81852366-81852388 GGGGCAGCGGAGGCGGCAGGCGG + Intergenic
993339002 5:86698865-86698887 GGGGGTGAGGAAGTCGCAGGAGG - Intergenic
994043573 5:95284517-95284539 AAGGAGGAGGACGCCGCCGGCGG + Exonic
994107471 5:95962365-95962387 GTGGGGGAGGACGCAGCAGGAGG + Intergenic
995764597 5:115602058-115602080 AGGGCGGGGGCCGCCGCCGGGGG - Intronic
997296681 5:132773060-132773082 GCAGCGGAGGACGGGGCAGGGGG - Intronic
997718746 5:136061709-136061731 GGGGCTGAGGATGCCTCAGTGGG - Intronic
997926217 5:138033119-138033141 GGGGCGGGGCAGGCCGCTGGTGG + Intronic
998467452 5:142357163-142357185 GGGGCGGAGGAGGCGGAAGCGGG - Intergenic
998957626 5:147453711-147453733 GGGGCGGAGGCGGGCGGAGGCGG - Intronic
999744349 5:154580416-154580438 GGGCCAGAGGACGCCACAGTTGG - Intergenic
1001101604 5:168818861-168818883 GGGGCCTTGGCCGCCGCAGGGGG + Intronic
1002927178 6:1611322-1611344 GGGGCGGAGGGCGCGGGCGGCGG - Exonic
1003062857 6:2876150-2876172 TGGGCGGCGGGCGCCGCAGGGGG + Intergenic
1004044676 6:12012381-12012403 GGAGCGGCGGCCGCCGGAGGAGG + Exonic
1005825283 6:29628307-29628329 TGGGCGGAGGGAGCCGCGGGAGG + Intronic
1010142014 6:72622640-72622662 AGCGCGGAGCACGCCCCAGGGGG - Intronic
1015880285 6:137865308-137865330 GGGGCAGTGGAAGCTGCAGGAGG + Intergenic
1018863673 6:167731486-167731508 GGGGCTCAGAACGCCGGAGGTGG + Intergenic
1018876840 6:167827844-167827866 CGGGCAGAGGCCGCCGCAGAGGG - Intronic
1019279669 7:193407-193429 GCGGCGGAGGAGGCGGCCGGGGG - Exonic
1019354770 7:572719-572741 GGGGAGCAGGAGGCCCCAGGTGG + Intronic
1019996036 7:4725081-4725103 GGCGCGGAGGACGCTGTGGGTGG - Intronic
1020204673 7:6105258-6105280 GGGGCGGCGGCCGCGGCGGGCGG + Intronic
1020224948 7:6272560-6272582 CGGGCTGGGGACGCCGCCGGAGG + Exonic
1022089047 7:27096033-27096055 AGGGCGGAGGACGCTGGAGGAGG + Intergenic
1022111571 7:27235575-27235597 GGGGCGGAGGGCGCAGAAAGGGG + Intergenic
1022207703 7:28180090-28180112 GGGGCGGAGGGCGCGGCGGGCGG - Intronic
1022207976 7:28180839-28180861 GGGGGGAAGGCCGCCGCAGCTGG + Intergenic
1022363375 7:29685054-29685076 GGGCCGGAGGCCGCCGCCGCGGG - Intergenic
1022739659 7:33109145-33109167 GGGGCGCGGGACGCCGCGGTGGG - Intronic
1023405807 7:39833241-39833263 GGCGCAGAGGGCGGCGCAGGCGG + Intergenic
1023861870 7:44221466-44221488 GGGGAGGAGGAAGCAGCAGGGGG + Intronic
1025230956 7:57203172-57203194 GAGGCGGAGGAGGCGGGAGGAGG - Intergenic
1029367675 7:100127160-100127182 GGGGCCGAGGACGCCGAGGGAGG + Intronic
1029438467 7:100575014-100575036 GGGGCTGAAGGCACCGCAGGTGG + Exonic
1029458708 7:100683647-100683669 GGGGCAGAGGCGGCTGCAGGTGG + Intronic
1029589680 7:101499103-101499125 GGGGAGGGGGAGGCCGCAAGAGG + Intronic
1030598059 7:111562512-111562534 GGGGCGGAGCTTGCCGCCGGCGG - Intronic
1034129114 7:148699208-148699230 TGGGCGGAGGACGCCGAAGGTGG + Intronic
1034261973 7:149762957-149762979 AGGGAGGAGGAGGCCGCTGGAGG - Intergenic
1034306252 7:150047572-150047594 GGGGCGGGGGACGGCGGCGGGGG - Intergenic
1034830599 7:154304846-154304868 GGGGCAGAGGTGGCCCCAGGAGG - Intronic
1035022669 7:155808576-155808598 GGGCCGGAGGAGGGCGCAAGGGG - Intronic
1036910900 8:12755819-12755841 GGGGCGAGGGCCACCGCAGGTGG - Intronic
1037281461 8:17246898-17246920 GGGGCGGAGAGCGCCCCCGGGGG + Exonic
1037825252 8:22156666-22156688 GGGCAGGAGGAGTCCGCAGGCGG - Exonic
1037928778 8:22865325-22865347 GCAGCGGGAGACGCCGCAGGGGG - Intronic
1038017641 8:23528967-23528989 GGGGCGCAGGAGGCTGCAGGAGG - Exonic
1038644455 8:29350804-29350826 GGGGCGGGGGACAGCGCGGGGGG - Intergenic
1039986581 8:42452726-42452748 GAGGGGGAGGAGGCCGCAGGAGG + Intronic
1041464752 8:58146737-58146759 GGGCCGCAGGAGCCCGCAGGAGG + Exonic
1042307189 8:67343884-67343906 GGGGCGGAGGGCGGCGCGGGAGG + Intergenic
1044250682 8:90001452-90001474 GGGCCGGAAGGCGGCGCAGGCGG - Exonic
1045737934 8:105318525-105318547 GGGGCGCAGGGCGCGGGAGGAGG - Intronic
1049070002 8:140349107-140349129 GGGGCTGAAGACGGCGCACGAGG + Intronic
1049320068 8:141991582-141991604 GGAGGTGAGGACGCCTCAGGTGG - Intergenic
1049406176 8:142452746-142452768 GGGGCGGAGGACGCCGCAGGAGG - Intronic
1049596958 8:143489284-143489306 TGGGCAGGGGACGCCCCAGGTGG + Intronic
1049689633 8:143952973-143952995 GGGGTGGCGCATGCCGCAGGGGG - Intronic
1049747418 8:144268886-144268908 GGTGAGGAGGGCGCTGCAGGTGG + Intronic
1049775621 8:144402792-144402814 GGGGCTGACGGCACCGCAGGTGG + Intronic
1051170220 9:14313953-14313975 GGGGCGCGGGAGGGCGCAGGAGG + Intronic
1052495025 9:29213936-29213958 GGGGCGGAGGTGGCCCCTGGAGG - Intergenic
1053364865 9:37515719-37515741 CGGGCTGAGGACTCCCCAGGAGG - Intronic
1056102436 9:83312745-83312767 GGGGCGCAGGGCGGCGGAGGGGG - Intronic
1056799474 9:89681371-89681393 GGGGCGGGGGCGGCCGCCGGGGG - Intergenic
1057619170 9:96619631-96619653 GGGGCGCCGGCCGCGGCAGGAGG - Exonic
1059357118 9:113708526-113708548 GTTGCGGAGGACACCTCAGGTGG + Intergenic
1060619428 9:125050272-125050294 GGGGTGGAGGTGGGCGCAGGGGG + Intronic
1061000419 9:127899425-127899447 GGGGCGGAGGGCGCCGGGAGAGG - Intronic
1061012120 9:127961878-127961900 GGGGCGGAGGATGCCGGGGCAGG + Intronic
1061450441 9:130664503-130664525 GGAGAGGAGGAGGACGCAGGAGG - Intergenic
1061488582 9:130933093-130933115 GGGCTCGAGGAAGCCGCAGGGGG + Intronic
1061832475 9:133304563-133304585 GGGGCCCAGGGCGCTGCAGGGGG - Intergenic
1061890143 9:133614978-133615000 GGGGCGGTGGGAGCCACAGGAGG + Intergenic
1061975884 9:134067891-134067913 GGGGCGGCGGGCGGCGCGGGCGG - Intronic
1062493694 9:136821752-136821774 GGGCTGGAGGGCGCTGCAGGCGG + Intronic
1062570754 9:137184095-137184117 GGCACGGGGGACGCCGCAGTGGG + Intronic
1062656413 9:137606241-137606263 GGGGCGCAGGGAGCCGCAGCAGG - Intronic
1187367197 X:18675295-18675317 CGGGCGGAGGAAGCTGCCGGGGG - Intergenic
1187464433 X:19515122-19515144 GCGGCGGAGGGCGCGGCAGGCGG - Exonic
1190598587 X:52068406-52068428 GGGACAGAGGAGGTCGCAGGAGG + Intronic
1190610237 X:52185667-52185689 GGGACAGAGGAGGTCGCAGGAGG - Intronic
1192212010 X:69133656-69133678 GAGGTGGTGGAAGCCGCAGGAGG - Intergenic
1193743430 X:85244811-85244833 GGGGCAGAGGAAGCTGGAGGAGG + Intronic
1195318661 X:103703216-103703238 GGGGCGCAAGACACCGGAGGTGG - Intergenic
1196865205 X:120065078-120065100 GGGGCAGAGGAGGAAGCAGGGGG + Intergenic
1196877888 X:120171202-120171224 GGGGCAGAGGAGGAAGCAGGGGG - Intergenic
1197746023 X:129932531-129932553 GGAGCGGCGGCTGCCGCAGGAGG - Intergenic
1199699652 X:150365670-150365692 GGGGCGGAGGGTGTGGCAGGAGG - Intronic
1200090521 X:153633813-153633835 GGAGGGGAGGACACTGCAGGCGG + Intergenic
1200100929 X:153688847-153688869 GGGGAGGAGGCCGCGGCGGGCGG - Intronic
1200246883 X:154531214-154531236 GGAGCGGAGGAGGACTCAGGAGG + Intergenic
1200786317 Y:7263748-7263770 GGGGCTGAGGCAGCCGCAGCGGG + Intergenic