ID: 1049406211

View in Genome Browser
Species Human (GRCh38)
Location 8:142452824-142452846
Sequence CGGGGACGCCGCGGGGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049406188_1049406211 25 Left 1049406188 8:142452776-142452798 CCCGACCCCGCCTCCGGGAGTGG 0: 1
1: 0
2: 2
3: 21
4: 220
Right 1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG No data
1049406199_1049406211 12 Left 1049406199 8:142452789-142452811 CCGGGAGTGGGTCGTGGGGCGCG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG No data
1049406198_1049406211 15 Left 1049406198 8:142452786-142452808 CCTCCGGGAGTGGGTCGTGGGGC 0: 1
1: 0
2: 2
3: 10
4: 114
Right 1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG No data
1049406190_1049406211 24 Left 1049406190 8:142452777-142452799 CCGACCCCGCCTCCGGGAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG No data
1049406193_1049406211 19 Left 1049406193 8:142452782-142452804 CCCGCCTCCGGGAGTGGGTCGTG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG No data
1049406194_1049406211 18 Left 1049406194 8:142452783-142452805 CCGCCTCCGGGAGTGGGTCGTGG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG No data
1049406192_1049406211 20 Left 1049406192 8:142452781-142452803 CCCCGCCTCCGGGAGTGGGTCGT 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049406211 Original CRISPR CGGGGACGCCGCGGGGCTCC AGG Intronic
No off target data available for this crispr