ID: 1049408066

View in Genome Browser
Species Human (GRCh38)
Location 8:142460479-142460501
Sequence GAGATGTTCTAGGGGATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049408051_1049408066 22 Left 1049408051 8:142460434-142460456 CCAATATGGCCTCTCCCAAGGCC 0: 1
1: 0
2: 0
3: 19
4: 139
Right 1049408066 8:142460479-142460501 GAGATGTTCTAGGGGATGCTGGG No data
1049408060_1049408066 1 Left 1049408060 8:142460455-142460477 CCTGGGCGGGGAGCAGCTCAGTC 0: 1
1: 0
2: 1
3: 27
4: 201
Right 1049408066 8:142460479-142460501 GAGATGTTCTAGGGGATGCTGGG No data
1049408059_1049408066 7 Left 1049408059 8:142460449-142460471 CCAAGGCCTGGGCGGGGAGCAGC 0: 1
1: 0
2: 6
3: 44
4: 447
Right 1049408066 8:142460479-142460501 GAGATGTTCTAGGGGATGCTGGG No data
1049408058_1049408066 8 Left 1049408058 8:142460448-142460470 CCCAAGGCCTGGGCGGGGAGCAG 0: 1
1: 0
2: 2
3: 24
4: 325
Right 1049408066 8:142460479-142460501 GAGATGTTCTAGGGGATGCTGGG No data
1049408048_1049408066 30 Left 1049408048 8:142460426-142460448 CCTTCCGGCCAATATGGCCTCTC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1049408066 8:142460479-142460501 GAGATGTTCTAGGGGATGCTGGG No data
1049408049_1049408066 26 Left 1049408049 8:142460430-142460452 CCGGCCAATATGGCCTCTCCCAA 0: 1
1: 0
2: 2
3: 16
4: 136
Right 1049408066 8:142460479-142460501 GAGATGTTCTAGGGGATGCTGGG No data
1049408056_1049408066 13 Left 1049408056 8:142460443-142460465 CCTCTCCCAAGGCCTGGGCGGGG 0: 1
1: 0
2: 3
3: 48
4: 353
Right 1049408066 8:142460479-142460501 GAGATGTTCTAGGGGATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049408066 Original CRISPR GAGATGTTCTAGGGGATGCT GGG Intronic
No off target data available for this crispr