ID: 1049408295

View in Genome Browser
Species Human (GRCh38)
Location 8:142461338-142461360
Sequence GAGTCCATCCCAGGTTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049408295_1049408298 1 Left 1049408295 8:142461338-142461360 CCCTGTGAACCTGGGATGGACTC 0: 1
1: 0
2: 2
3: 17
4: 186
Right 1049408298 8:142461362-142461384 TCCGTGTTTTCTCACCAAGCTGG No data
1049408295_1049408300 13 Left 1049408295 8:142461338-142461360 CCCTGTGAACCTGGGATGGACTC 0: 1
1: 0
2: 2
3: 17
4: 186
Right 1049408300 8:142461374-142461396 CACCAAGCTGGAGCCTGTCCTGG No data
1049408295_1049408304 28 Left 1049408295 8:142461338-142461360 CCCTGTGAACCTGGGATGGACTC 0: 1
1: 0
2: 2
3: 17
4: 186
Right 1049408304 8:142461389-142461411 TGTCCTGGGACACCCCTCCCAGG No data
1049408295_1049408301 14 Left 1049408295 8:142461338-142461360 CCCTGTGAACCTGGGATGGACTC 0: 1
1: 0
2: 2
3: 17
4: 186
Right 1049408301 8:142461375-142461397 ACCAAGCTGGAGCCTGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049408295 Original CRISPR GAGTCCATCCCAGGTTCACA GGG (reversed) Intronic
902324032 1:15686849-15686871 GAGACCATCCCTGGTTAACATGG - Intronic
911209760 1:95126877-95126899 AAGGCCAGCCCAGGTTCACAGGG + Intronic
912390233 1:109297688-109297710 CTGTCCACCCCAGGTCCACAGGG + Intronic
913547588 1:119884808-119884830 AAATCCTTCCCAAGTTCACACGG - Intergenic
914757492 1:150572229-150572251 GGGTTCCTCCCAGGTTCACGTGG + Intergenic
915533196 1:156516300-156516322 GAGGCCTTCCCAGATTCAAAGGG + Intergenic
918650992 1:186962920-186962942 GATTCCAAGCCAGGTTCACAAGG - Intronic
922549038 1:226480560-226480582 GAGTGCATCCCAGCTCCAGAAGG - Intergenic
922934073 1:229410390-229410412 GCATCCATCCCAGGCACACAGGG + Intergenic
1063535315 10:6877075-6877097 CATTCCTTCCCAGATTCACAAGG + Intergenic
1064601991 10:17003375-17003397 GATTCTAGCGCAGGTTCACAGGG - Intronic
1065534999 10:26707877-26707899 GGGTTCTTCCCAGGTTCCCAAGG - Intronic
1067270701 10:44789199-44789221 GAGTGCATCCCAGGTTCTGTGGG - Intergenic
1067284289 10:44896054-44896076 CAGTCCAGCCCAGATTCAGAGGG + Intergenic
1067415828 10:46101646-46101668 GTATCCATCCCAGGTTCCCAAGG - Intergenic
1067435837 10:46276433-46276455 GTATCCACCCCAGGTTCCCAAGG - Intergenic
1067435897 10:46276924-46276946 GTATCCATTCCAGGTTCCCAAGG - Intergenic
1068117837 10:52753373-52753395 GAGTCAATCTCAAGTTCAAATGG + Intergenic
1069894845 10:71673943-71673965 GAGCTCATCCCAGGTTCTCAGGG - Intronic
1070822781 10:79372189-79372211 GGCTCCATCCCAGATTCAGAAGG - Intergenic
1071236368 10:83654891-83654913 GAGTACACACCAGGCTCACATGG - Intergenic
1071436761 10:85654725-85654747 GAGGCCATCCCAGGCACTCAGGG + Intronic
1072274774 10:93812471-93812493 GAGACCATCCCTGGCTGACACGG + Intergenic
1075836980 10:125462329-125462351 GAGTTCATCCCAGGTGCAAAGGG - Intergenic
1075963132 10:126586468-126586490 GAGTCCATTCAAGGTTCATGTGG + Intronic
1076067597 10:127461125-127461147 TTGTCCCTCCCAGGCTCACATGG - Intergenic
1076663283 10:132069431-132069453 GAATCCATCCCATCTTCACCAGG + Intergenic
1079911974 11:26321639-26321661 GACTACATCCCAGAATCACATGG - Intronic
1080689785 11:34546803-34546825 GAGAGCATGCCAGTTTCACAAGG - Intergenic
1080711256 11:34750056-34750078 GAGTCAAACCCAGCTTCACTGGG + Intergenic
1080913288 11:36627436-36627458 GAGCCAAACCCAGGATCACAAGG - Intronic
1080950445 11:37026311-37026333 CATTCCATATCAGGTTCACACGG - Intergenic
1081233665 11:40618775-40618797 AAGTCCATCCCACTTCCACAGGG + Intronic
1081268075 11:41051497-41051519 CAGTCCCTCCCAGGGTCTCAAGG + Intronic
1082822270 11:57552152-57552174 GACTCACTCCCAGGTTCACCTGG - Exonic
1083750142 11:64756288-64756310 CAGTCCATGCCAGGTGCACGTGG - Intronic
1084069094 11:66722371-66722393 GAGACCATCCCTGGCTAACACGG + Intronic
1084255906 11:67942586-67942608 GAGTCCATGGCAGCCTCACATGG - Intergenic
1084961240 11:72717890-72717912 GAGGCCATGCCAGGGTCCCAGGG + Intronic
1085972508 11:81610573-81610595 TAGTCCATCCTAGGTTTTCAGGG + Intergenic
1086612848 11:88778084-88778106 GAGCCCATCACAGGTCAACAAGG - Intronic
1090472286 11:126990737-126990759 GGGTCCACCCCACATTCACAAGG - Intronic
1090512229 11:127387479-127387501 AAGTTCTTCCCAGGTTCAAAGGG - Intergenic
1090605496 11:128419380-128419402 AAGGCCAGCCCAGATTCACAGGG + Intergenic
1092129917 12:6103124-6103146 GAGACCATCCCTGGCTAACACGG + Intronic
1092426143 12:8377326-8377348 GAGTCCATGGCAGCCTCACATGG - Intergenic
1100328828 12:93567085-93567107 GAGTGCATCCCAGGATCACAGGG + Intergenic
1100429414 12:94517266-94517288 GCAGCCATTCCAGGTTCACAGGG - Intergenic
1101215949 12:102583043-102583065 GAGGGCATTCCAGGTTTACAAGG - Intergenic
1101545409 12:105707520-105707542 GAGTCCCTCCCAAATTTACAGGG - Intergenic
1102563552 12:113779598-113779620 AAGTCCAGCCCAGGTTCAAGGGG - Intergenic
1102608371 12:114088706-114088728 GAGACAATGCCAGCTTCACATGG + Intergenic
1103596415 12:122026873-122026895 GAATCCATCCCAGATTCTCCAGG - Intronic
1104945038 12:132412014-132412036 GAGTCCAGCCGGGGGTCACAGGG + Intergenic
1108362862 13:49683323-49683345 GAGACCATCCCTGGCTAACACGG + Intronic
1109009623 13:56923500-56923522 CAGTCCATCCCATGTGAACATGG - Intergenic
1109133633 13:58620314-58620336 GAGTCGATCCCTGGTTTAGAAGG + Intergenic
1109406533 13:61907611-61907633 GAGTCCATCCCAGCAACTCAGGG + Intergenic
1110326208 13:74218498-74218520 CAGCACCTCCCAGGTTCACATGG + Intergenic
1110367609 13:74704798-74704820 AAGTCTATCCCAGGTTCAAAGGG + Intergenic
1110561079 13:76911248-76911270 GCGTCCCTTCCAGGTTAACAGGG - Intergenic
1113779929 13:112970590-112970612 GCGTGGATGCCAGGTTCACAGGG + Intronic
1114568321 14:23648338-23648360 GTGGGCATCCCAGGTTCCCAAGG + Intergenic
1115512268 14:34149360-34149382 GATTCCAATCCAGCTTCACAGGG - Intronic
1117921414 14:60728686-60728708 GAGACCATCCTGGGTTAACATGG + Intergenic
1118693221 14:68359975-68359997 GAGCCCAGCCCAGGCTGACAAGG - Intronic
1120070819 14:80100349-80100371 GAATCCCACCCAGGCTCACATGG + Intergenic
1121881684 14:97506588-97506610 GATTTTCTCCCAGGTTCACATGG - Intergenic
1124476299 15:30037937-30037959 GAGTCCAGCCCATATACACAAGG + Intergenic
1125280607 15:38038605-38038627 GAGACCATTCCTGGTTAACATGG - Intergenic
1125809457 15:42525164-42525186 GAGACCATCCCTGGCTAACACGG + Intronic
1126731811 15:51691268-51691290 GAGTCCATCCATGGCTCATAAGG - Intronic
1128769071 15:70268421-70268443 GAGGTCACCCCAGGTGCACATGG - Intergenic
1129663829 15:77568191-77568213 GACTCCGTCCCAGGTCCTCAGGG - Intergenic
1130541681 15:84824874-84824896 GAGTCCATCCCACATTCGAATGG + Intronic
1130822398 15:87509189-87509211 GAGTGCCTCCCTGGTTCACACGG - Intergenic
1133383488 16:5350226-5350248 GAGTCCATCTGAGTTTCTCATGG - Intergenic
1135458163 16:22617001-22617023 GAGTCCATCCCACTTTTGCAGGG - Intergenic
1136033373 16:27519543-27519565 GAGTTCAGCCCAGTCTCACATGG + Intronic
1139563806 16:67760311-67760333 GGGTCTGTGCCAGGTTCACAAGG - Intronic
1140505393 16:75468701-75468723 GAGACCATCCCTGGCTAACACGG + Intergenic
1141100193 16:81191943-81191965 GAGTCCATCCCCATTTCTCAGGG + Intergenic
1141382863 16:83591434-83591456 GAGTGAATCCCAGGAGCACATGG - Intronic
1141892898 16:86939001-86939023 GACTCCAACCCAGGTTCATCTGG - Intergenic
1142227731 16:88885679-88885701 GAGTCCATGCCCGGCACACAGGG + Intronic
1143950228 17:10626571-10626593 GAGTGCATGCCAAGTGCACATGG + Intergenic
1148852853 17:50563060-50563082 GAGTCCCTGCTAGGCTCACAGGG - Intronic
1149693153 17:58595436-58595458 GAGGCCAGCCCAGATTCACTGGG - Intronic
1150180804 17:63118981-63119003 GAGACCATCCCTGGCTAACATGG - Intronic
1152368054 17:79868829-79868851 AAGTCCGTCCCAGATTTACATGG - Intergenic
1153888076 18:9485496-9485518 GAATCCATCTCAAGTGCACATGG - Intronic
1153905005 18:9653447-9653469 GAGTCCACCCCAGATCAACAAGG - Intergenic
1155911215 18:31506168-31506190 GAATCAAACCCAGGTTCACCTGG + Intronic
1155992082 18:32288135-32288157 GAGTTCATCCCCAGTACACAGGG + Exonic
1157797494 18:50588510-50588532 AAGACCAGCCCAGATTCACAGGG + Intronic
1159070439 18:63617059-63617081 TAATTCATCCCAGGTTCACCTGG + Intergenic
1160528063 18:79548760-79548782 GCATCCACCCCAGGCTCACAGGG + Intergenic
1160842208 19:1151222-1151244 GAGTCCGTCTCAGGCACACACGG + Intronic
1161456074 19:4370350-4370372 GAGTCCATCCCATACCCACAAGG + Intronic
1162617700 19:11815072-11815094 GAGACCATCCCTGGCTAACACGG + Intronic
1165312876 19:35039535-35039557 GTCTCCACCCCAGGTACACAGGG - Intronic
1167954901 19:53056880-53056902 CAGTCCAGCCCAGCTTCCCACGG - Intergenic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
930447403 2:51491209-51491231 GAGTGCATTGCAGATTCACAAGG + Intergenic
930753543 2:54954328-54954350 CAGTGCATCCCAGGGTCCCAGGG + Intronic
932682976 2:73842447-73842469 GAGTCCATCCCAGCAGCTCAAGG - Intronic
937151229 2:119687286-119687308 GATTCTATTCCAGGCTCACACGG - Intergenic
944674683 2:202025470-202025492 GAGTCCATCCCAGACTAGCATGG + Intergenic
945396526 2:209325190-209325212 GAGCCCATCGCAGGTGCAGAGGG - Intergenic
945419940 2:209622408-209622430 GTGTCCTTCCCAGCATCACAAGG - Intronic
1170926470 20:20729226-20729248 CAGTTCATCTCAGGTTTACATGG + Intergenic
1171306630 20:24112565-24112587 GTGTCCATCCCATGCTCACAGGG + Intergenic
1172442532 20:34976346-34976368 GAGGCCAGACCAGGCTCACACGG - Intronic
1174678526 20:52381404-52381426 AAGTCCAGCCCACATTCACAGGG - Intergenic
1176518955 21:7810633-7810655 GAGCCCATCCCAGAGGCACAGGG - Intergenic
1178652983 21:34440646-34440668 GAGCCCATCCCAGAGGCACAGGG - Intergenic
1179655984 21:42845011-42845033 GGGCCCAGCCCAGGGTCACACGG + Intronic
1179999934 21:44991021-44991043 GAGTCCAGCCGAGGTTCGGAGGG + Intergenic
1181313086 22:21956035-21956057 GAGGCCCTCACAGGTTAACACGG - Intergenic
1181346193 22:22222107-22222129 GAGGCCCTCACAGGTTAACACGG - Intergenic
1182283734 22:29232243-29232265 GATTCCATTGCAGGTCCACAGGG + Exonic
1183540068 22:38424687-38424709 GAGGCCAGCCCAGATTCAAAGGG - Intergenic
1184063346 22:42099293-42099315 GAGACCATCCCTGGCTAACACGG - Intergenic
1184396974 22:44248061-44248083 CAGACCACCCCAGGTCCACAAGG + Exonic
949296635 3:2532285-2532307 CAGTCCAGCCCAGGGTGACAGGG - Intronic
951000062 3:17548111-17548133 GAGACCATCCAAGGCTAACATGG + Intronic
957070820 3:75566641-75566663 GAGTCCATGGCAGCCTCACATGG - Intergenic
960360993 3:116710942-116710964 GAGTGCTTCCCAAGGTCACATGG + Intronic
966493399 3:180553034-180553056 TAGTGCAACCCAGGTTCACCGGG + Intergenic
968078725 3:195832052-195832074 GAGACCATCCCTGGCTAACACGG + Intergenic
968896576 4:3407474-3407496 GAGTCCATACCAGGGTCAGCCGG - Intronic
969739533 4:9014115-9014137 GAGTCCATGGCAGCCTCACATGG + Intergenic
969798711 4:9545649-9545671 GAGTCCATGGCAGCCTCACATGG + Intergenic
970951771 4:21764993-21765015 GGCTCCATCCCAAGTTGACATGG - Intronic
974307078 4:60156097-60156119 GAGTCCACCACAGCTTAACAAGG - Intergenic
974883162 4:67784383-67784405 AAGACCATCCCTGGTTAACATGG + Intergenic
980121996 4:128737372-128737394 GAGTCCATCCCGGTACCACAAGG + Intergenic
985001289 4:185486351-185486373 GAGTTTATCCCAGGGTTACAAGG - Intergenic
985481952 5:118408-118430 GAATCCTTCCCAAGTACACATGG + Intergenic
986496177 5:8344214-8344236 GAGCCCATCCCAGCATAACATGG - Intergenic
987144512 5:14979357-14979379 AAGTCCAACCCAGATTCACTGGG + Intergenic
987170946 5:15257440-15257462 CAGTCCATACCATGTTGACATGG - Intergenic
988093314 5:26569564-26569586 GGGGCCTTCCCAGGTTCCCAAGG + Intergenic
991641447 5:68758348-68758370 GAGACCATCCCAGGTGTCCAGGG - Intergenic
992929509 5:81628195-81628217 GAATCCATGGCAGATTCACATGG + Intronic
996017899 5:118561464-118561486 GAGTCCATCCCATCTTCCAAGGG - Intergenic
997405575 5:133644100-133644122 GTGTCCTTCCCAGGGCCACAGGG + Intergenic
997596287 5:135109297-135109319 GAGTCCAGCTGAGGTTCGCAAGG + Intronic
997992831 5:138560308-138560330 GAATCCTTCCCAGATTTACAAGG - Intronic
998747607 5:145278708-145278730 GGGTCCATCCAAGGAACACAAGG + Intergenic
1000285983 5:159826511-159826533 GTGCCCATCCCAGGTTCCCAGGG - Intergenic
1001589323 5:172854675-172854697 GAGCCCATCCCAGCTGCTCAGGG - Intronic
1001952619 5:175826722-175826744 TAGGCCAACCCAGGTTCCCAGGG + Intronic
1002110003 5:176902318-176902340 GAGACCCTCTCAGGTTCATACGG + Intergenic
1005567715 6:27113442-27113464 GATTCCATCCCAAGTTCATCAGG - Intergenic
1006138937 6:31915474-31915496 GAGTCCATATAAAGTTCACAGGG - Intronic
1006470278 6:34224608-34224630 GAGTTCATCCCTGGTTCCCCCGG - Intergenic
1006949418 6:37809200-37809222 GAGTCCATCCCAGCCACACATGG + Intergenic
1008942931 6:57066822-57066844 GAGTCCTTCCTAGGTTCCCTGGG + Intergenic
1019748697 7:2715213-2715235 GACCCCACCCCAGGTTCACGGGG + Exonic
1022434129 7:30362914-30362936 GAGACCATCCCTGGCTAACACGG + Intronic
1022556923 7:31307203-31307225 TTGCCCATACCAGGTTCACACGG - Intergenic
1022888252 7:34668640-34668662 ATGTCCATCACAGGTTAACAGGG + Intronic
1024231409 7:47366725-47366747 GTGGCCTGCCCAGGTTCACATGG - Intronic
1024762895 7:52621631-52621653 GAATCCAACCCAGGTTATCATGG + Intergenic
1026129295 7:67606883-67606905 GCTGCCATCCCAGGTTCCCATGG - Intergenic
1026583486 7:71636971-71636993 GACTCCATCCCAGGTTGAGCTGG - Intronic
1029043644 7:97603858-97603880 GAGACCATTCCTGGTTAACACGG + Intergenic
1029073100 7:97915943-97915965 GAGTCCATGGCAGCCTCACATGG - Intergenic
1033399352 7:141007219-141007241 GATTTGAACCCAGGTTCACATGG - Intronic
1033420582 7:141201318-141201340 GAATCTTTCCCAGGGTCACACGG - Intronic
1036178803 8:6565840-6565862 GAGTCCATGCCAGCTGCACATGG - Intronic
1036244582 8:7105336-7105358 GAGTCCATGGCAGCCTCACATGG + Intergenic
1036897246 8:12646093-12646115 GAGTCCATGGCAGCCTCACATGG - Intergenic
1040804752 8:51382036-51382058 GAGACCATCCTGGGTTAACATGG - Intronic
1041166271 8:55095782-55095804 GAGTCCATCCTAGGAAGACAGGG + Intergenic
1043026939 8:75082099-75082121 GAGTGCATCCCAGGATCACATGG + Intergenic
1044436565 8:92171120-92171142 GAGTCCATCACATGTGCACTCGG - Intergenic
1045080978 8:98625555-98625577 GAGTCTATCTCAGTTTAACAAGG + Intronic
1045647037 8:104309076-104309098 GAGTCCACCACAGGTAAACAAGG + Intergenic
1045887164 8:107112438-107112460 GAGTCCCTCCCAGGAAAACATGG - Intergenic
1048223296 8:132562928-132562950 GAGGCCGGCCCAGGTTCAAAGGG - Intergenic
1048251450 8:132869688-132869710 GGGCCCATCCCAGGGTCACCTGG + Intronic
1048408308 8:134145358-134145380 GAATCCATCCCAGTGTCACAAGG - Intergenic
1049107052 8:140620664-140620686 GAGACCAGCCCAGGCTAACATGG + Intronic
1049169697 8:141151879-141151901 GAGTCCATCACGGGGACACATGG + Intronic
1049376129 8:142290022-142290044 GAGGCCTGCCCAGGTGCACAGGG - Intronic
1049376865 8:142293524-142293546 GAGACCTGCCCAGGGTCACATGG + Intronic
1049408295 8:142461338-142461360 GAGTCCATCCCAGGTTCACAGGG - Intronic
1051739873 9:20240852-20240874 GAGACCTTCCCAGGTGCAGAAGG - Intergenic
1053020658 9:34691707-34691729 GAGGCCACCCCAGGATCTCATGG - Intergenic
1053594341 9:39544661-39544683 GAATTCATCCCAGATTCACTGGG - Intergenic
1053852123 9:42299705-42299727 GAATTCATCCCAGATTCACTGGG - Intergenic
1054571912 9:66820297-66820319 GAGTTCATCCCAGATTCACTGGG + Intergenic
1057397212 9:94690844-94690866 GAGTCCAGCCCAGATTCAGAGGG + Intergenic
1057548454 9:96035025-96035047 GAGTCCTTCCCAGGCCCCCAAGG - Intergenic
1058392179 9:104508069-104508091 GTGCCCATCCTAGGTTCCCATGG - Intergenic
1058798953 9:108526147-108526169 GAGTCCATCTGAGGTTCTGAGGG + Intergenic
1060278195 9:122198085-122198107 GATTCCAACCAAGGTTCACCAGG - Intronic
1060785726 9:126450470-126450492 GAGTACATCCCTGGTCCACAAGG - Intronic
1186882511 X:13880472-13880494 GAGACCATCCCTGGCTAACATGG + Intronic
1187685557 X:21812334-21812356 AAGTCCAGCTCAGATTCACAGGG + Intergenic
1192801183 X:74466078-74466100 GGCTCCATCCCAGGCCCACAGGG + Intronic
1193419892 X:81270859-81270881 GAGTCCACCCCAGCTTAGCAAGG - Intronic
1201947249 Y:19524909-19524931 GAATCCATCCCACTTTGACATGG - Intergenic