ID: 1049409033

View in Genome Browser
Species Human (GRCh38)
Location 8:142464264-142464286
Sequence GCTGCTGGGACGCCGCGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049409017_1049409033 29 Left 1049409017 8:142464212-142464234 CCGCCGCCCCGGGCCCCGTCTGG 0: 1
1: 0
2: 7
3: 60
4: 730
Right 1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 163
1049409024_1049409033 15 Left 1049409024 8:142464226-142464248 CCCGTCTGGATCCTCGCCCCGCT 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 163
1049409020_1049409033 23 Left 1049409020 8:142464218-142464240 CCCCGGGCCCCGTCTGGATCCTC 0: 1
1: 0
2: 5
3: 9
4: 116
Right 1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 163
1049409026_1049409033 4 Left 1049409026 8:142464237-142464259 CCTCGCCCCGCTGCTACTGCTGC 0: 1
1: 0
2: 4
3: 60
4: 447
Right 1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 163
1049409027_1049409033 -1 Left 1049409027 8:142464242-142464264 CCCCGCTGCTACTGCTGCTGCTG 0: 2
1: 16
2: 88
3: 283
4: 963
Right 1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 163
1049409021_1049409033 22 Left 1049409021 8:142464219-142464241 CCCGGGCCCCGTCTGGATCCTCG 0: 1
1: 0
2: 1
3: 11
4: 105
Right 1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 163
1049409022_1049409033 21 Left 1049409022 8:142464220-142464242 CCGGGCCCCGTCTGGATCCTCGC 0: 1
1: 0
2: 2
3: 8
4: 112
Right 1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 163
1049409023_1049409033 16 Left 1049409023 8:142464225-142464247 CCCCGTCTGGATCCTCGCCCCGC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 163
1049409028_1049409033 -2 Left 1049409028 8:142464243-142464265 CCCGCTGCTACTGCTGCTGCTGC 0: 2
1: 87
2: 197
3: 525
4: 1755
Right 1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 163
1049409029_1049409033 -3 Left 1049409029 8:142464244-142464266 CCGCTGCTACTGCTGCTGCTGCT 0: 4
1: 69
2: 189
3: 565
4: 1632
Right 1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 163
1049409019_1049409033 26 Left 1049409019 8:142464215-142464237 CCGCCCCGGGCCCCGTCTGGATC 0: 1
1: 0
2: 2
3: 16
4: 149
Right 1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 163
1049409025_1049409033 14 Left 1049409025 8:142464227-142464249 CCGTCTGGATCCTCGCCCCGCTG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049409033 Original CRISPR GCTGCTGGGACGCCGCGCGC GGG Exonic
900123614 1:1059789-1059811 GATTCTGGGCCGCCGTGCGCCGG - Intergenic
900146898 1:1162448-1162470 GCTGCAGGGAGGCGGCGGGCAGG + Intergenic
900413480 1:2524386-2524408 GCTGCTGGGAGGCCACGCTCAGG - Intronic
901317397 1:8318233-8318255 CCTGCCGGGGCGCCGCGCCCTGG + Intronic
901373069 1:8817251-8817273 GCTGCGGGGCCGCGGGGCGCAGG + Exonic
901633761 1:10660199-10660221 GCTGCTGGGCAGCCGCAGGCCGG + Exonic
902509524 1:16958633-16958655 GCTGCAGGGCCGCCTGGCGCTGG + Exonic
902916609 1:19643828-19643850 GGTGCCGGGACGCGGCGGGCTGG + Intronic
905912072 1:41662096-41662118 GCGGCGGGGGCGCGGCGCGCGGG + Intronic
913519506 1:119631727-119631749 GCTCCTGGCCCGCCGCCCGCCGG - Intronic
913670972 1:121097306-121097328 GCAGCTGGGTCCCCGGGCGCTGG - Intergenic
914022735 1:143884727-143884749 GCAGCTGGGTCCCCGGGCGCTGG - Intergenic
914661222 1:149792671-149792693 GCAGCTGGGTCCCCGGGCGCTGG - Intronic
917920274 1:179744392-179744414 GCTGCTGGGACCCCGCCACCCGG + Intronic
918077948 1:181184593-181184615 GCTGCTGGGACACTGCATGCAGG + Intergenic
918423514 1:184386869-184386891 GCCGCCGGGGCGCAGCGCGCTGG - Intergenic
919779441 1:201212811-201212833 GATGCTGGGAAGCAGCCCGCAGG + Exonic
920312695 1:205058021-205058043 GTTGCTGGCATGCCGCGCCCGGG + Exonic
924052372 1:240092076-240092098 GCTGCTGCGCCGCCGCGCCGCGG - Exonic
1062774614 10:135239-135261 GCGGCCGGGTCGCCGCGTGCGGG - Intronic
1063120281 10:3101064-3101086 GCTGCTGTGACACCGCAGGCTGG + Intronic
1064443231 10:15371437-15371459 GCTGCGGGGATGGGGCGCGCCGG - Intergenic
1065140532 10:22714655-22714677 GCGGCTGCGGCGCCGCGGGCGGG + Intergenic
1067497749 10:46774848-46774870 CCTGCCCGGACGCCGCGCCCAGG - Intergenic
1067596900 10:47565566-47565588 CCTGCCCGGACGCCGCGCCCAGG + Intergenic
1072638887 10:97196237-97196259 GCTGCCCCGACGCCGCGGGCCGG - Intronic
1074585991 10:114768182-114768204 GGTGCGGGGACGCCGCCCGCAGG + Intergenic
1076758439 10:132587522-132587544 GCTGTTGGGACGCGGGGAGCAGG + Intronic
1076999579 11:315948-315970 GCTGCTGGGCCGTGGCGAGCTGG - Intergenic
1077521830 11:3040867-3040889 GCTGCAGGGACACCCCGCGGTGG + Intronic
1088679467 11:112226636-112226658 GCTGCTGGGGCGACGCGCGCTGG + Intronic
1094339002 12:29389655-29389677 GCCGCTTGAACGCCGCGCGGCGG + Intergenic
1098255345 12:68610766-68610788 GGGGCGGGGCCGCCGCGCGCCGG - Intergenic
1099202126 12:79690078-79690100 GCCGCTGGGAAGCCCCCCGCGGG - Exonic
1104602421 12:130162547-130162569 GCTGTGGGGGCGCCGCGAGCTGG + Exonic
1104809909 12:131613882-131613904 GCGGCTGGGACGGAGCCCGCCGG - Intergenic
1105004203 12:132710955-132710977 GCGGTAGGGAAGCCGCGCGCAGG + Exonic
1105767977 13:23579548-23579570 CCTCGCGGGACGCCGCGCGCCGG - Intronic
1105930426 13:25047262-25047284 GCGGCTGGGAGGTCCCGCGCTGG - Intergenic
1106226852 13:27792664-27792686 GCTGCGGGGCGACCGCGCGCCGG + Exonic
1109140778 13:58712048-58712070 GCTGCTGGGCCGCCCCACTCAGG + Intergenic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1112272028 13:97976897-97976919 GCTGCGCGGCCGCCGCCCGCCGG - Intronic
1113670144 13:112170726-112170748 GCTGCTGGGACCCCAAGCCCAGG - Intergenic
1113881044 13:113626507-113626529 GCTGCGGGGAAGCGGGGCGCAGG - Intronic
1117097701 14:52314680-52314702 GCTGCTGGCGCGCCGCTGGCGGG + Exonic
1117176783 14:53153376-53153398 GCTGCACCGGCGCCGCGCGCGGG + Intergenic
1120853416 14:89191319-89191341 GCAGCTGGGACGCTGCGCTGGGG - Intronic
1122694184 14:103544883-103544905 TCTGCTCGGAGGCCGCGCACTGG - Intergenic
1122905793 14:104800876-104800898 GCGTCGGGGACGCCGCGAGCGGG + Intronic
1202893736 14_KI270722v1_random:183562-183584 GCTGCTGGGAGGGCGGGCGTGGG + Intergenic
1125606474 15:40942269-40942291 GCTGCTGCGACGGCGGGGGCAGG - Intergenic
1128224633 15:65993386-65993408 GCTGCTGGGCCGCTGGGAGCTGG - Intronic
1129082495 15:73052741-73052763 GCTGCTCGGGCGCCGGGCGCCGG + Exonic
1129450280 15:75647691-75647713 CCAGCTGGGAAGCCGCGCGGAGG + Intronic
1132971508 16:2691529-2691551 GCTGCGTGGACTCGGCGCGCCGG - Intronic
1134070204 16:11255913-11255935 GCTGCGGGAGCCCCGCGCGCGGG + Intronic
1135066513 16:19314800-19314822 GCTTCTGGGACGCTGTGGGCAGG + Intronic
1136365586 16:29807706-29807728 GCTGCTGGCACACCGGGCACTGG - Exonic
1136448167 16:30336509-30336531 ACTGCTGGTTCGCCGCGCACAGG - Intergenic
1141418975 16:83899402-83899424 ACTGCTGGGCCGCCTGGCGCGGG + Exonic
1141827971 16:86494274-86494296 GCGGCGGGGAGGCAGCGCGCCGG + Intergenic
1141946934 16:87317142-87317164 GCTGCCGGGGGGCCGGGCGCGGG - Exonic
1142683129 17:1562055-1562077 GCCGAGGGGACGCCGAGCGCTGG - Intronic
1142954600 17:3513024-3513046 CCTGCTGGGCCGCCGCGATCTGG - Intronic
1145885746 17:28381395-28381417 GCTGCTGCGCCACTGCGCGCTGG + Exonic
1148122642 17:45221938-45221960 CCCGATGGGACGCCGCGCTCCGG + Exonic
1148206490 17:45783401-45783423 GCTGCTAGGAGCCCGCGGGCAGG - Intergenic
1148682560 17:49483087-49483109 GCTGCTGGGAGGCAGCCCCCGGG - Intergenic
1149296268 17:55265010-55265032 GCTGCGGGGCCGCGGAGCGCTGG + Exonic
1151975730 17:77482726-77482748 GCTGCTGGGAAGCCTCTGGCCGG - Intronic
1152005343 17:77676924-77676946 GCTGCTGGAATGCCCCACGCAGG + Intergenic
1152088282 17:78233236-78233258 GCTCCTGGGAAGCCTCGCTCTGG - Intronic
1152663207 17:81552473-81552495 GCTGCAGGGACTCCGGGAGCTGG + Intronic
1157260636 18:46173478-46173500 GCTGGTGGGACGTGGCCCGCTGG - Intergenic
1159770494 18:72542165-72542187 ACTGGTGGGAGGCGGCGCGCGGG + Exonic
1160566227 18:79788204-79788226 GCTCCGGGGACGCGGCTCGCGGG - Intergenic
1161065912 19:2237126-2237148 CCTGTTGGGAGGCCGCGCGCGGG + Intronic
1162378969 19:10321013-10321035 GCTGGTGTGGTGCCGCGCGCAGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162799475 19:13102911-13102933 GCTGCTAGGTCCCCGCCCGCTGG - Intronic
1163161869 19:15469697-15469719 GCTGCTGGGCCACCGCCAGCTGG - Exonic
1163548303 19:17951890-17951912 GCTGCTGGGACACTGGGCCCTGG + Intronic
1163720420 19:18895868-18895890 GCTGCTGGCGCTCGGCGCGCTGG - Exonic
1165080211 19:33302462-33302484 GCGGCGGCGACGCCCCGCGCAGG - Exonic
1167269487 19:48499224-48499246 GCGGCTGGGACCCCGAGGGCCGG - Exonic
925944963 2:8852309-8852331 GCTACTGGGAAGCAGAGCGCTGG - Intergenic
928511909 2:32010541-32010563 GCAGCGGGGACGCCGGGGGCCGG - Exonic
929420539 2:41785538-41785560 GCTGCTGGGATGCAGCTCCCGGG - Intergenic
930016667 2:46975436-46975458 GCTTCTGGGACACCGAGAGCAGG - Intronic
930096686 2:47571050-47571072 GCTGCTGCGACGCCTCCCGGTGG + Intergenic
931566819 2:63622955-63622977 GCTGCTTGGGCGCCGTGCGGTGG - Intronic
931762554 2:65431105-65431127 GATCCTGGGCCGCCCCGCGCGGG - Intronic
935150279 2:100427709-100427731 GCTTCTGGGAGGCCGGGCTCTGG + Intergenic
937160938 2:119760190-119760212 GCTGCTGGGCAGCCGCGGGCCGG - Exonic
946163126 2:217848032-217848054 CCTGCTGGGAGGCTGCTCGCGGG + Exonic
946231061 2:218291649-218291671 GCTGCTGGGAGGCCAGGCCCTGG - Intronic
948466683 2:238155576-238155598 GCTGCTGGGAAGCCAGGCCCGGG + Intergenic
1169143659 20:3239269-3239291 GCCGCTCAGACGCCGCGCCCGGG + Intergenic
1172581230 20:36050556-36050578 GCAGCTCGAACGCCGCGCGGCGG - Intergenic
1172703024 20:36863966-36863988 CCTGCCCGGACGCCGGGCGCAGG - Intergenic
1174342492 20:49906543-49906565 GCTGCTCGGACGCCCTGCGGCGG - Exonic
1175215839 20:57391389-57391411 GCTGCGGGGACTCTGCGCCCCGG - Exonic
1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG + Intergenic
1176173754 20:63708145-63708167 GCGGCTGGGAAACCGCGCGGAGG + Exonic
1176207205 20:63895475-63895497 GCTGCTGCGACGCCGCGGCCTGG + Intronic
1176274332 20:64255385-64255407 GGTGCTGGGAGGCCGCCCGAGGG + Intergenic
1178839917 21:36130173-36130195 GCAGCGGGGACGCCGGGGGCCGG + Intergenic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1183541239 22:38430630-38430652 GCTGCTGGGATGCTGCGGGAGGG - Intronic
1183545955 22:38455046-38455068 GCGCCCGGGACGCCGCCCGCCGG - Exonic
1183780337 22:39995153-39995175 GCTGCTGGGCGGCGGCGAGCAGG + Exonic
1184523800 22:45009858-45009880 GCGGCTGGGCGGGCGCGCGCGGG - Intronic
1185376489 22:50484823-50484845 GCTGCTGGGCCTCCGCGTGATGG - Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
953656951 3:44861816-44861838 GCTCCTGTGACGCCACGCTCCGG - Intronic
956414531 3:69013138-69013160 GCGGCTGAGACGCCGCGCTGGGG + Intronic
960960452 3:123067156-123067178 GCTGCTGGGATGGCGCGGGCCGG + Exonic
961336034 3:126180312-126180334 GCCGCTGGGACGCCGGGCTCGGG - Intronic
965590433 3:170356977-170356999 GCAGCTGGGCCGCCCCGCCCCGG - Intergenic
965590480 3:170357131-170357153 GCCGCTCGGACGCCGCGCAGCGG - Intergenic
966711904 3:182980388-182980410 GCTGCAGGGTCGCCGCGGGACGG + Intronic
966936323 3:184711957-184711979 GCTGCTGGGCCGCACCGCACGGG + Exonic
968093204 3:195910357-195910379 GCCGCTGGGAATCCGAGCGCTGG - Intronic
968431121 4:559757-559779 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431125 4:559772-559794 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431139 4:559832-559854 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431146 4:559862-559884 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431153 4:559892-559914 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431174 4:559982-560004 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968445465 4:650112-650134 GGTGCTGGGACGCTGGGCACGGG + Intronic
968620985 4:1603421-1603443 GCTGCTGGGCCGCCCACCGCAGG + Intergenic
968627178 4:1631218-1631240 GCTGCTGGGAAGCCCCAAGCAGG - Intronic
969681926 4:8647928-8647950 GCTGCTGGCACGAGGCGCTCAGG + Intergenic
969681934 4:8647967-8647989 GCTGCTGGCACGAGGCGCTCAGG + Intergenic
969716648 4:8871267-8871289 GCTGCGGAGGCGCAGCGCGCTGG - Exonic
970427960 4:15962983-15963005 GCTGCTGGGACGCATAGTGCAGG + Exonic
978361105 4:107931793-107931815 GCTGCGGAGGCGCCGGGCGCGGG + Exonic
985537400 5:472951-472973 GCCGCTGTGACGCCGCCGGCGGG - Exonic
985760253 5:1745274-1745296 GCTGCTCTGAGGCCGCTCGCTGG - Intergenic
987989331 5:25190622-25190644 GCCGCTCGAACGCCGCGCGGCGG - Intergenic
992690701 5:79237361-79237383 GCTGCTGGTGCACGGCGCGCAGG - Exonic
995512330 5:112921836-112921858 GCAGCTGCGGCGCCGGGCGCTGG - Intronic
1001577323 5:172772465-172772487 GCTGCAGCGACGCGACGCGCTGG + Intergenic
1002487813 5:179551261-179551283 GCCGCTGGTCCGCTGCGCGCAGG - Intronic
1002743287 5:181449772-181449794 GCTGCTGAGACGGCACCCGCGGG + Intergenic
1004983004 6:21047283-21047305 GCTGCTGAGAAGCCAGGCGCTGG + Intronic
1005512380 6:26522091-26522113 GCCGCTCGAACGCCGCGCGGCGG + Intergenic
1008817085 6:55580543-55580565 GCTGCTGGGACTACAGGCGCCGG + Intergenic
1013991025 6:116253776-116253798 GCAACTGGGACGCGGAGCGCGGG + Exonic
1019159346 6:170058664-170058686 ACTGCAGGGACGCTGCACGCAGG + Intergenic
1025779020 7:64582800-64582822 GCTGTTCGGACGCTGCGCGCGGG + Intergenic
1025959063 7:66205009-66205031 GCTGCAGGGGAGCCGCGGGCAGG - Intergenic
1026595838 7:71733390-71733412 GCTCCTTGGACGTCCCGCGCGGG + Intergenic
1035361556 7:158316831-158316853 GCTTCTGCAACGCCACGCGCAGG + Exonic
1037825233 8:22156599-22156621 GCGGCTGGGCCACCCCGCGCGGG + Exonic
1039608409 8:38901149-38901171 GGTGCCGGGGCGCCGCGGGCTGG - Intergenic
1040599542 8:48870318-48870340 GCTGCCCGGGCGGCGCGCGCTGG + Intergenic
1041689848 8:60678520-60678542 GCTGCTGGGCCGCGGGCCGCGGG - Intergenic
1041726587 8:61023707-61023729 GCCGCCGGGAGGCTGCGCGCCGG + Intergenic
1045277634 8:100721850-100721872 GCTGCTGCGGGGCCGCGGGCGGG + Exonic
1045564460 8:103299077-103299099 GCGGCTGGGATGAGGCGCGCCGG + Intronic
1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG + Exonic
1049643280 8:143725084-143725106 GATGCTGGGAGGCAGCGAGCAGG + Exonic
1049785848 8:144450330-144450352 GGTGCTGGGATGCCGCCCGTGGG + Exonic
1057432136 9:95004673-95004695 GCTGCCGGGAAGCCGCTCGCAGG + Intronic
1057619133 9:96619492-96619514 GCTGCGGGGACGGCGGGCGCCGG + Exonic
1058885882 9:109320823-109320845 GCTGCTCCCGCGCCGCGCGCCGG + Exonic
1059747204 9:117214577-117214599 GCTGCTGGGTCCCCAGGCGCGGG - Exonic
1061861949 9:133472757-133472779 GCTGCTGAGACCCAGCGCCCAGG + Intronic
1062535085 9:137017901-137017923 GCTGCGGGGAGGCCGCGCTCAGG + Exonic
1187226027 X:17375926-17375948 GGTGCAGGGACGGCGCGGGCTGG - Exonic
1192237647 X:69306098-69306120 GCTGCTGGGAGGCTCCGCCCGGG - Intergenic
1192440716 X:71171429-71171451 GCTGCAGGAACCCAGCGCGCTGG - Intergenic
1193397583 X:81003830-81003852 GCCGCTCGAACGCCGCGCGGCGG - Intergenic
1198398802 X:136250830-136250852 CCCGCAGGGACTCCGCGCGCCGG - Intronic
1199457152 X:148042195-148042217 GCAGCTGGGACTACGGGCGCCGG + Intergenic