ID: 1049409443

View in Genome Browser
Species Human (GRCh38)
Location 8:142465903-142465925
Sequence AAAGCCAGTGTCCCAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 278}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049409443_1049409449 22 Left 1049409443 8:142465903-142465925 CCAGCCTCTGGGACACTGGCTTT 0: 1
1: 0
2: 5
3: 29
4: 278
Right 1049409449 8:142465948-142465970 TGCGCAGGAGCAGCGTCCTCGGG No data
1049409443_1049409448 21 Left 1049409443 8:142465903-142465925 CCAGCCTCTGGGACACTGGCTTT 0: 1
1: 0
2: 5
3: 29
4: 278
Right 1049409448 8:142465947-142465969 GTGCGCAGGAGCAGCGTCCTCGG No data
1049409443_1049409445 -5 Left 1049409443 8:142465903-142465925 CCAGCCTCTGGGACACTGGCTTT 0: 1
1: 0
2: 5
3: 29
4: 278
Right 1049409445 8:142465921-142465943 GCTTTTCCTGCTCATGAGACAGG No data
1049409443_1049409447 7 Left 1049409443 8:142465903-142465925 CCAGCCTCTGGGACACTGGCTTT 0: 1
1: 0
2: 5
3: 29
4: 278
Right 1049409447 8:142465933-142465955 CATGAGACAGGAGCGTGCGCAGG No data
1049409443_1049409450 23 Left 1049409443 8:142465903-142465925 CCAGCCTCTGGGACACTGGCTTT 0: 1
1: 0
2: 5
3: 29
4: 278
Right 1049409450 8:142465949-142465971 GCGCAGGAGCAGCGTCCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049409443 Original CRISPR AAAGCCAGTGTCCCAGAGGC TGG (reversed) Intronic
901181862 1:7347400-7347422 AAAGCCCGTGACCCTGGGGCTGG - Intronic
901391236 1:8947636-8947658 AAGCCCACTGTCTCAGAGGCTGG - Intronic
901921489 1:12540589-12540611 AACGCCAAGTTCCCAGAGGCAGG + Intergenic
903337823 1:22636705-22636727 GAGGCCAGAGTCCCAGAGGGAGG + Intronic
903411809 1:23150808-23150830 AAACCCACTTTCCCAGAAGCTGG + Intronic
903477156 1:23627486-23627508 AAGGGCAGTGTCCCAGTGGAGGG - Exonic
903606414 1:24578224-24578246 TGAGACAGTGTCCCACAGGCTGG - Intronic
904604014 1:31689215-31689237 AAGGCCAGCACCCCAGAGGCAGG + Intronic
904922560 1:34020422-34020444 AAAGCCACTGTCCATGAGACGGG + Intronic
905217615 1:36420515-36420537 AAACCCAGTGGCCCTGAGCCCGG - Exonic
905226247 1:36481102-36481124 AAAACCAGTGTCCCAAAATCTGG - Intronic
905468932 1:38177145-38177167 AAAGCCAGTGTCACAGACAGAGG - Intergenic
905913409 1:41669237-41669259 AGAGGCAATGTCCCAGAGGGTGG + Intronic
906264180 1:44416533-44416555 AAAGACTGTGTCACACAGGCAGG - Intronic
906698632 1:47841690-47841712 AAAGGCAGGTTCCCAGAGCCAGG + Intronic
908197410 1:61758788-61758810 AGAGTCAGTGTCTCACAGGCTGG + Intronic
908771193 1:67597976-67597998 AAAGACTGTGTCTCAGAGGAAGG + Intergenic
915328291 1:155092555-155092577 AATGCCAGCCTCTCAGAGGCAGG - Intergenic
918134474 1:181659269-181659291 AATGCCTGTGCCCCAGAGGCAGG - Intronic
918720246 1:187843120-187843142 ACAGAAAGTGTCCCAGATGCTGG - Intergenic
919057652 1:192591057-192591079 GATGCCAGTGCCCCAGAGGAGGG + Intergenic
919844500 1:201632934-201632956 AAAGCTAGTGTGCCTGGGGCAGG + Intronic
922034306 1:221833451-221833473 ATAGCCAGTGTCCCTGTGGAAGG - Intergenic
922346975 1:224704412-224704434 AAACCCAGGGATCCAGAGGCAGG + Intronic
924614477 1:245601178-245601200 GAAGCCAGTGTCCCAGTAGAAGG - Intronic
1064604659 10:17026334-17026356 AAAGCAAGAATCACAGAGGCTGG + Intronic
1065283183 10:24161711-24161733 AATGCCAGTGCCTGAGAGGCTGG - Intronic
1066065315 10:31757396-31757418 AAAGCCAGGCCCCCCGAGGCCGG - Intergenic
1067958871 10:50825028-50825050 GAAGGCAGAGTCCCTGAGGCTGG + Intronic
1069773490 10:70913792-70913814 AATGCCAGTGCCCCAGTGGAGGG + Intergenic
1070285847 10:75083188-75083210 TAAGACAGTGTCCCAGATGTAGG - Intergenic
1071431859 10:85612864-85612886 AGAGCTAGTGTCCCCCAGGCTGG + Intronic
1071525771 10:86357302-86357324 AAGGACAGTATCCCAGAGGAAGG + Intronic
1072659474 10:97354750-97354772 AAAGTCAGTGTTCTTGAGGCCGG - Intergenic
1073481454 10:103788568-103788590 TAAACTAGTGTCCCTGAGGCCGG + Intronic
1074390739 10:113056102-113056124 AAAGCTTCTGTCCCAGAGTCAGG - Intronic
1074459104 10:113620900-113620922 AAAGCCACTGTCCCAAGGGATGG - Intronic
1076037302 10:127210604-127210626 ACAGGCAGTGGCTCAGAGGCAGG - Intronic
1076526194 10:131113665-131113687 CCAGCCAGGGTCCCCGAGGCTGG + Intronic
1076658465 10:132039564-132039586 GAAGCCAGTGAGCCACAGGCAGG - Intergenic
1076985265 11:231607-231629 ACAGCCAGGGTCCCAGCTGCAGG + Intronic
1078904675 11:15672681-15672703 AAAGACAGTGTCCCCAAGTCTGG - Intergenic
1079504587 11:21139303-21139325 AAAGCAAGTGTCCCTGAGTTAGG - Intronic
1082842911 11:57703946-57703968 CAAGGCAGTGTCCAAGAGCCTGG + Exonic
1084346725 11:68556566-68556588 TGAGCCATTGTCCCAAAGGCAGG + Intronic
1084624774 11:70297835-70297857 AAAGCAAGTGGCCCAGACGAGGG - Intronic
1085771454 11:79329716-79329738 AAGGCCAGTGCATCAGAGGCTGG + Intronic
1087212383 11:95457291-95457313 AAATGCAATGGCCCAGAGGCTGG - Intergenic
1091084878 11:132712068-132712090 AAAGCCCCTGTCCCATAGGGTGG + Intronic
1091136886 11:133199469-133199491 AAATCCAGTGACAGAGAGGCAGG + Intronic
1091191094 11:133695814-133695836 CAGGCCAGTGTCCCAGATGAAGG - Intergenic
1093056828 12:14564390-14564412 AAAGGCAGTGTCCCAAAATCAGG + Intronic
1093539471 12:20264643-20264665 AAAGGAAGTGTCCTAGAGGCAGG - Intergenic
1096936540 12:55286242-55286264 TAAGACAGTGTCTCAGAGGCTGG + Intergenic
1098150053 12:67537482-67537504 AAGGCCAGTGCCCCAGAGGCAGG - Intergenic
1099976397 12:89550074-89550096 AAAGGCAGTCTCCCTGAGACAGG + Intergenic
1099979424 12:89581587-89581609 AAAGCAAGTGACCCAGAAGAGGG + Intergenic
1101706676 12:107226809-107226831 AAAGTCAGTGACACAGTGGCAGG + Intergenic
1105407927 13:20146591-20146613 CAAGGCTGTGTCCCAGAGACAGG + Intronic
1106825423 13:33515055-33515077 AAGGCCAGAGTACTAGAGGCTGG + Intergenic
1107908498 13:45083636-45083658 AAAGCCTGTGTCCCTGAACCTGG - Intergenic
1108437056 13:50411103-50411125 AAAGTCAGTATCCCAGGGGCTGG + Intronic
1108449777 13:50549541-50549563 AAAGCCATTGCCCCAGGGGTTGG - Intronic
1108562487 13:51659436-51659458 AAAGTCAGTGTCCCACTGCCAGG - Intronic
1109552329 13:63919547-63919569 AACTCCAGAGTCCCAGAAGCAGG - Intergenic
1113294300 13:108941054-108941076 AAAACCAGTGAGCCACAGGCTGG + Intronic
1113637231 13:111928047-111928069 AAAGTCAGTATCACAGAGGAGGG - Intergenic
1113909502 13:113835544-113835566 AAAGCCCTCGTCACAGAGGCAGG + Exonic
1114523996 14:23356888-23356910 ACAGCCAGTCTTCCAGAGGTGGG + Exonic
1115212713 14:30983964-30983986 AAATACAGTGTCTGAGAGGCAGG + Intronic
1115307181 14:31945045-31945067 AAATCTTCTGTCCCAGAGGCTGG - Exonic
1118669191 14:68103437-68103459 AAATGAAGTGGCCCAGAGGCAGG + Intronic
1120198090 14:81508448-81508470 AAAGACAGTGTCTGAGAGCCAGG + Intronic
1121439252 14:93938575-93938597 AAAGCCAGCGACCCAGAGGCAGG - Intronic
1122425921 14:101605185-101605207 GGGGCCACTGTCCCAGAGGCAGG - Intergenic
1122970085 14:105148959-105148981 AAAGCCACTGTCACAGATGCAGG + Exonic
1123751151 15:23359229-23359251 AAAGCCAGGCTCCCAGGGGACGG - Intronic
1124137064 15:27044014-27044036 AAAGCCAGTTTCCCAGTGGAGGG - Intronic
1124320400 15:28707706-28707728 AAAGCCAGACTCCCAGGGGATGG + Intronic
1124482114 15:30087704-30087726 AAAGCCAGGCTCCCAGGGGATGG - Intronic
1124488572 15:30139804-30139826 AAAGCCAGGCTCCCAGGGGATGG - Intronic
1124543658 15:30608776-30608798 AAAGCCAGGCTCCCAGGGGATGG - Intronic
1124674695 15:31674257-31674279 AGAGCCGGTGGCCAAGAGGCTGG + Intronic
1124754956 15:32398518-32398540 AAAGCCAGGCTCCCAGGGGATGG + Intronic
1125513110 15:40303312-40303334 AAAGCGAGTATCCCGGATGCTGG + Exonic
1126351220 15:47746709-47746731 TAAGCCAGTGTTCCACAGACAGG + Intronic
1127135193 15:55912952-55912974 ACAGACAGTGTCCCAGATACAGG + Intronic
1127440791 15:59005313-59005335 AAAGCCTATGTTCTAGAGGCTGG - Intronic
1127846182 15:62873518-62873540 GAAGCCAGTGTTTGAGAGGCAGG + Intergenic
1129432060 15:75506468-75506490 AAAGCAAGACACCCAGAGGCAGG + Intronic
1129547963 15:76418257-76418279 GAAGACAGTGTGGCAGAGGCAGG - Intronic
1131377883 15:91940398-91940420 TAAGCCAATGTCCCTGAGTCTGG - Intronic
1131400160 15:92118757-92118779 AAACACAGAGTCCCAGAGGAAGG - Intronic
1132331053 15:101012836-101012858 AAAGCCAGGGACCCAGGGACAGG + Intronic
1132410089 15:101570943-101570965 AAAACAAGTTTCCCAAAGGCTGG + Intergenic
1132940158 16:2502372-2502394 GAAGCCTGGGTCACAGAGGCAGG + Exonic
1134145397 16:11756862-11756884 CAAGCCACAGTCCCAGAGGGCGG + Intronic
1135030557 16:19034792-19034814 AAGGGTAGAGTCCCAGAGGCAGG + Intronic
1137496732 16:48975206-48975228 AAAGCAAATGTCCCAGGGGGTGG - Intergenic
1137527028 16:49245258-49245280 AAGGCCATTGTCCCAGACACTGG - Intergenic
1137760257 16:50934744-50934766 AAAGCCAGTGGCCAGGAGCCAGG - Intergenic
1138146960 16:54621390-54621412 AAAACCAATGGCCCATAGGCTGG - Intergenic
1139747744 16:69088076-69088098 AGAGCCAGTGTGCCAGGGACTGG + Intergenic
1140833962 16:78776362-78776384 TAAGCAAGTGTCACAGAGGCAGG - Intronic
1140861861 16:79025192-79025214 AAAGACAATGTCACTGAGGCTGG + Intronic
1141514805 16:84536694-84536716 AAAACCAGAGTCCAGGAGGCCGG + Intronic
1141804881 16:86335961-86335983 GCAGCCACTGGCCCAGAGGCCGG - Intergenic
1141924801 16:87160993-87161015 AAATCCACTGCCCCAGAGGGAGG + Intronic
1142492696 17:289050-289072 AAAGCCTGTGTCCCGTGGGCAGG - Intronic
1142963793 17:3567869-3567891 AAAGACATTGACCCAGTGGCAGG - Intronic
1143282869 17:5767716-5767738 AAAGGGAGAGTCCCAGAGGTGGG - Intergenic
1143434736 17:6915060-6915082 AATGCCAGTTTCCCAGAAGTGGG - Intronic
1143447201 17:7016634-7016656 AGCTCCAGTGTCCCTGAGGCCGG + Exonic
1144698809 17:17323351-17323373 AAAGCCGCTGTCACAGAGGTGGG - Intronic
1145785807 17:27593228-27593250 AAAGCCTGTGTCCCCCAGGAGGG + Intronic
1146723377 17:35138804-35138826 AAAACCACTGTGGCAGAGGCAGG + Intronic
1148338176 17:46855436-46855458 ACAGAGAGTGTCCCAGAGCCAGG - Intronic
1148908304 17:50925733-50925755 AAACCCAGTGGCCCTTAGGCTGG - Intergenic
1151084700 17:71366805-71366827 AAAGAAACTGTCCCCGAGGCTGG + Intergenic
1151915947 17:77118113-77118135 CATGCCAGTGTCCCAGTAGCTGG + Intronic
1152039442 17:77893443-77893465 AAAGCCAGTGTCCCAGGATGCGG + Intergenic
1155865116 18:30955371-30955393 GAAGCCACTGTTCCAGTGGCAGG + Intergenic
1156830247 18:41483207-41483229 AAAGCCTATGTCCCAAAGCCTGG + Intergenic
1157210558 18:45738654-45738676 AAAGCCAGAGACCCAAAGCCAGG - Intronic
1158563464 18:58534722-58534744 AAGGCCAGTGTCCCCCAGGTGGG - Intronic
1159377867 18:67617080-67617102 AAAGCCAGTATTGCAGAAGCAGG + Intergenic
1160272364 18:77398665-77398687 AGACTCACTGTCCCAGAGGCTGG + Intergenic
1160674846 19:384481-384503 ACAGCCTGTTTCCCAGAGGAGGG + Intergenic
1162236786 19:9315829-9315851 ATAGCAGGTGTCCCAGGGGCAGG + Intergenic
1162301460 19:9847420-9847442 AGCCCCAGGGTCCCAGAGGCAGG - Intronic
1163275877 19:16283886-16283908 CCAGCCAGGGGCCCAGAGGCGGG - Intergenic
1164147539 19:22521290-22521312 AAAGCCAGTTGCCCAGACCCTGG + Intronic
1164746699 19:30621704-30621726 GGAGCCGGTGTCCCACAGGCTGG + Intronic
1165595455 19:37008669-37008691 AAGGCCAGTGTTCCAGTGACAGG - Intronic
1166087286 19:40485334-40485356 AGAGACAGTGTTCGAGAGGCTGG + Intronic
1168233878 19:55049803-55049825 AAAATCACAGTCCCAGAGGCTGG + Intronic
1168346022 19:55650595-55650617 AAAGCCAGATCCCCAGATGCTGG - Intronic
925336746 2:3104373-3104395 AAACCCAGGGTCCCAGAGCAGGG + Intergenic
925393802 2:3518534-3518556 AAAGCTAGCGTTACAGAGGCAGG + Intronic
925631885 2:5902738-5902760 AAAGAGAGAGTCCCAGAGGGTGG + Intergenic
926299726 2:11593811-11593833 ACAGCCACTGTTCTAGAGGCTGG + Intronic
926833157 2:16987384-16987406 AAAGCCAGATCCCCAGAGGATGG - Intergenic
927441562 2:23122098-23122120 AAAGCCAAGGTCAGAGAGGCTGG + Intergenic
927884875 2:26712247-26712269 AAGGGCAGTGTCCCCGAGGATGG + Intronic
929040936 2:37743751-37743773 AAGGCCAGACTCCCAGAGCCTGG - Intergenic
929807660 2:45161204-45161226 AAGGGCAGTGTCACACAGGCTGG - Intergenic
929931210 2:46257002-46257024 AAAGCCAGTTTTCCAGAGGAAGG - Intergenic
929947392 2:46381454-46381476 AAAGGCAGAGTCTCAGAGGCAGG - Intronic
930327359 2:49936968-49936990 AAGGCCAGGGGCCCAGAGGCAGG - Intronic
932330879 2:70897685-70897707 AGAACCTGTGTTCCAGAGGCTGG + Intergenic
932586018 2:73029557-73029579 TAAGCCAGGGCCCCAGGGGCTGG + Intronic
934030607 2:88042446-88042468 AAAACCAGAGTCCCTGAGGCTGG + Intronic
935419500 2:102852842-102852864 AAAGCTACCCTCCCAGAGGCTGG - Intergenic
936067757 2:109344939-109344961 AGAGCCACTGGCACAGAGGCAGG + Intronic
937901056 2:127019469-127019491 GAAGTCTGTGTCCCACAGGCTGG + Intergenic
938247152 2:129786624-129786646 AAAGCAGGTGTCCCTGAGGATGG + Intergenic
938307140 2:130263993-130264015 AGAGCGGGTGTCCCAGGGGCTGG + Intergenic
938803302 2:134783197-134783219 AAAGCAAGTGAACCAGAGGAGGG + Intergenic
938964850 2:136379321-136379343 AAAGCCACTGCCCCAGAGGCAGG - Intergenic
940383816 2:153047099-153047121 AATGGCAAAGTCCCAGAGGCAGG - Intergenic
942246046 2:174009650-174009672 AAACCCAGTGTATCACAGGCAGG + Intergenic
942326414 2:174780436-174780458 AAAGCAAGGTTCCCAGAGCCTGG - Intergenic
942616223 2:177794483-177794505 AAAACAAATTTCCCAGAGGCAGG + Intronic
944523690 2:200597172-200597194 ACAGCCAGAGTGTCAGAGGCAGG - Intronic
944931354 2:204523158-204523180 AAACCCAGGGTCTCAGAAGCTGG - Intergenic
948512000 2:238474694-238474716 AGAGACAGTGTGGCAGAGGCAGG + Intergenic
948707961 2:239806929-239806951 ACAGGCTGTGTCCCAGAGGGAGG + Intergenic
948831625 2:240601134-240601156 GGAGCCACTGTCCCCGAGGCAGG + Intronic
1168812102 20:710763-710785 AAAACCAGAGGCCCAAAGGCAGG + Intergenic
1170600717 20:17839304-17839326 ACAGGGAGTGGCCCAGAGGCTGG + Intergenic
1170692137 20:18625468-18625490 ATCCCCAGTGCCCCAGAGGCTGG - Intronic
1173194551 20:40903562-40903584 AAAGGCAAAGACCCAGAGGCAGG + Intergenic
1173382312 20:42557059-42557081 CAACCCAGTGTGGCAGAGGCAGG + Intronic
1175414274 20:58791390-58791412 AGAGGCAGAGACCCAGAGGCAGG - Intergenic
1181631219 22:24152522-24152544 AGAGCCAGTGTCCCACAGCAGGG + Intronic
1183346954 22:37313238-37313260 TAACCCAGTGTCCCATGGGCAGG - Intronic
1183357045 22:37365114-37365136 AGGCCCAGTGTCTCAGAGGCTGG - Intergenic
1184499479 22:44863186-44863208 AAGGCCAGGGTCACAGAGGGAGG + Intergenic
1185126254 22:49012373-49012395 GACGCCAGTGCCCCAGAGGCTGG + Intergenic
1185166248 22:49264155-49264177 AAAGCCAGGGCCACACAGGCCGG - Intergenic
1185396907 22:50597082-50597104 AGTGCCTGTGGCCCAGAGGCTGG + Intronic
951061439 3:18211390-18211412 ACAGCCATTGTGCCAGGGGCTGG - Intronic
951444652 3:22764676-22764698 AAAGCCAGTCTCCCAGAAGATGG + Intergenic
953568330 3:44051867-44051889 AAAGCTAGTGTCTCAGAGGCTGG - Intergenic
953686401 3:45081618-45081640 ACAGCCAGTCTCTCAGAGGCTGG - Intergenic
954000706 3:47554550-47554572 AAAGGTACTGTCACAGAGGCAGG - Intergenic
955028768 3:55196315-55196337 AAATGCAGTTTCCCAGGGGCAGG + Intergenic
960164491 3:114386152-114386174 TAAGCCAGAGTCCCATAGGTTGG - Intronic
961273929 3:125711890-125711912 GAATCCAGTGTCTCTGAGGCAGG + Intergenic
961683842 3:128616611-128616633 CAGGCCAGAGTCCCAGAGTCAGG + Intergenic
963457818 3:145568626-145568648 AAAGCAAGTTTTCCATAGGCTGG + Intergenic
963833874 3:150036730-150036752 AAGGCCAGTGTTCCAGATGATGG - Intronic
967308709 3:188085585-188085607 AGAGGCAGTGTCCGAGAAGCAGG - Intergenic
968509033 4:987338-987360 AGAGCCAGGGCCCCAGAGGAGGG - Intronic
968666352 4:1824366-1824388 AGAGGCAGTGTCACTGAGGCCGG + Intronic
968714137 4:2141854-2141876 AATGCCAGCGCCCCACAGGCTGG - Intronic
968913640 4:3487802-3487824 AAAGCCAATGCCCCACAGGTGGG - Intronic
969116775 4:4875197-4875219 AAAGCTAGGGTCCCAGAGGAAGG - Intergenic
969364502 4:6686296-6686318 GAAGTCAGTGACCCAGGGGCTGG + Intergenic
971765447 4:30824899-30824921 AAATTCAGTGGCACAGAGGCTGG + Intronic
972157714 4:36185219-36185241 AAAGCTAGAGTCCCAGAGTAGGG - Intronic
980272778 4:130608252-130608274 AAAGCCAGTGGCCCAGAGTGAGG - Intergenic
980839734 4:138243557-138243579 AAAGCCTGTGTGCGAGAGGTTGG + Intergenic
981576351 4:146209913-146209935 AAAGCCAGGTTACCAGAGTCTGG - Intergenic
981885137 4:149665422-149665444 GAAGACAGTGTATCAGAGGCAGG + Intergenic
981950159 4:150396388-150396410 CAAGCTAGAGACCCAGAGGCTGG - Intronic
982085548 4:151832422-151832444 AAATCCAGTTTCCCAGCAGCAGG + Intergenic
982092902 4:151896010-151896032 AAGGCCAGTGTTTCACAGGCTGG + Intergenic
982786491 4:159543113-159543135 AAGGTCAGTGGCTCAGAGGCAGG + Intergenic
984795763 4:183659011-183659033 GAAGGCAGCGGCCCAGAGGCCGG + Exonic
985489250 5:169636-169658 GAAGCCGGTGTCAGAGAGGCGGG + Intronic
985919886 5:2962041-2962063 AAAGCCAGTGCCCAAGGGCCTGG - Intergenic
987073753 5:14361354-14361376 AGAGCCAGTGTGCCACAGCCTGG + Intronic
989710846 5:44395104-44395126 ATAGCCAGAGTCCTAGAGGAGGG - Intergenic
994003839 5:94814511-94814533 AAAAGCAGGGTCCTAGAGGCAGG + Intronic
994019692 5:95008481-95008503 AAAGCCAGTCTCCCAAAAGATGG - Intronic
995102465 5:108329844-108329866 AAAGCCACTGTTCCCGAGCCTGG - Intronic
996236426 5:121136597-121136619 AATGCCAGTGACCAAGAGGAGGG - Intergenic
996855635 5:128003369-128003391 AAAGCCAGGGTCCCAGAAAAGGG - Intergenic
997387814 5:133487515-133487537 AAAGCCTGAGGCTCAGAGGCAGG - Intronic
998897412 5:146814627-146814649 CAATCCAGTGTTCCAGAGGGAGG - Intronic
999400985 5:151264063-151264085 AAAACCAGGGTCCCACAGGCTGG - Intronic
999428015 5:151504306-151504328 AAAGGCAGTGGACCAGAGGGAGG + Exonic
999914092 5:156238422-156238444 AAAAGCAGTTGCCCAGAGGCTGG - Intronic
1000560524 5:162783041-162783063 TAAGCCAGCCTCCCAGAAGCTGG + Intergenic
1001130395 5:169058987-169059009 AAAGCCAGGGACCCAAATGCTGG + Intronic
1001276901 5:170357926-170357948 AAAGCCTGACTCCCAGAGCCAGG + Intronic
1001311649 5:170615253-170615275 AAAGCCACTTTCCCACAGCCTGG + Intronic
1001817298 5:174680727-174680749 AAACCCAGTGGCCCAGAAGAGGG + Intergenic
1002261400 5:177996038-177996060 AGAGACAGAGTCCCAGAGGGTGG - Exonic
1003315046 6:5004211-5004233 AAATTCACTGTCCCAGTGGCTGG + Intergenic
1003613438 6:7633637-7633659 ACAGCCAGGGTGCCAGAGCCAGG - Intergenic
1005108160 6:22248027-22248049 AAAGCCAGTGTCTGAGAGTGAGG + Intergenic
1006074936 6:31526140-31526162 ATAGCCACAGGCCCAGAGGCAGG - Intergenic
1009992701 6:70863572-70863594 TTGGCCAGTGTCCCAGGGGCAGG - Intronic
1013830599 6:114268097-114268119 AAGGCCAGTGAACCAGAGGAGGG - Intronic
1014952720 6:127577171-127577193 AAAGCCATTGTGCCAGAGCTGGG - Exonic
1016997410 6:149970215-149970237 ATTCCCAGAGTCCCAGAGGCCGG + Intronic
1017455407 6:154597058-154597080 AAAGCAAGGGCCTCAGAGGCTGG - Intergenic
1017917813 6:158846195-158846217 AAAGCCAGTGGGGCAGAGGCTGG + Intergenic
1018149046 6:160921420-160921442 ATATGCAGGGTCCCAGAGGCAGG + Intergenic
1018305854 6:162454577-162454599 AAAGCCACTGACACAGAGGAGGG - Intronic
1018606009 6:165598840-165598862 ATAGCCAGCCTCCCAGCGGCTGG - Intronic
1018702745 6:166440034-166440056 AAGTCCAGTGTCCCCAAGGCTGG - Intronic
1018915387 6:168129606-168129628 GAAGACAGCGTTCCAGAGGCCGG + Intergenic
1019348867 7:543786-543808 AAAGACAGTTTTCCAGAGGCTGG - Intergenic
1019584146 7:1787563-1787585 ACAGCCAGAGTCCAAGAGGCAGG - Intergenic
1019803012 7:3102524-3102546 AAAGTGAGAGTCTCAGAGGCAGG - Intergenic
1019839925 7:3430870-3430892 AAAGACAGAGAGCCAGAGGCAGG - Intronic
1020907069 7:14076518-14076540 AGAGTTACTGTCCCAGAGGCTGG + Intergenic
1022489484 7:30805576-30805598 AGAGCCAGTCTCCTGGAGGCAGG + Intronic
1023407862 7:39855115-39855137 GAAGGCAGCGGCCCAGAGGCCGG + Intergenic
1026295964 7:69052718-69052740 TAAGCCACAGTCCCAGAGCCTGG + Intergenic
1026466167 7:70656687-70656709 CAGGACAGTGTCTCAGAGGCAGG - Intronic
1027217385 7:76192713-76192735 AAGGCCACTGGCCCAGGGGCAGG + Intergenic
1029443211 7:100599685-100599707 GAAGCAAGTCTCCCCGAGGCTGG + Intronic
1029590902 7:101506483-101506505 AGAGCCACTGTCCCAGGGGGTGG - Intronic
1029933218 7:104395645-104395667 AAAGCCAGTATCTCAGTGGCAGG - Intronic
1031053303 7:116967452-116967474 CAGGTCAGTGTCCCAGAGGCAGG + Exonic
1031163850 7:118202782-118202804 GAAGCAAGTATCTCAGAGGCAGG + Intergenic
1032199190 7:129807271-129807293 ACAGCCAGAGGCCCAGATGCAGG - Intergenic
1032291844 7:130596122-130596144 AAATCCCATGTCCCAGTGGCTGG + Intronic
1034789736 7:153957424-153957446 AAAGCCTGAGTCTGAGAGGCCGG - Intronic
1036619834 8:10417334-10417356 AATTCCATTGTCCCAGAGCCTGG + Intronic
1037920493 8:22802189-22802211 TTAGCCAGTGGCCCAGAGTCGGG - Intronic
1038903853 8:31875138-31875160 AAAGCTATATTCCCAGAGGCAGG - Intronic
1041815142 8:61962104-61962126 AGAGCCAGAGTGCCAGTGGCAGG - Intergenic
1041958385 8:63582797-63582819 AAGGGCAGTGTCCCAGTGGAAGG + Intergenic
1042373949 8:68026649-68026671 AAAGCCAGTGTCAGAGAAGGAGG - Intronic
1045424734 8:102054174-102054196 CAAGCCATTGTCTCAGGGGCAGG + Intronic
1047379103 8:124339794-124339816 TTAGCCAGTGTCCCAGAAGGTGG - Intronic
1049157278 8:141074864-141074886 AAAGCAGGTGTCCGCGAGGCCGG + Intergenic
1049409443 8:142465903-142465925 AAAGCCAGTGTCCCAGAGGCTGG - Intronic
1049636842 8:143693621-143693643 AGAGCCAGTGGCCCACAGCCAGG - Intronic
1050693948 9:8259139-8259161 AAAGAAAATGTCCCAGAGGCTGG + Intergenic
1053351598 9:37417054-37417076 ACACCCACTGCCCCAGAGGCTGG + Intergenic
1053365649 9:37520812-37520834 AAAGCATGTGTGCCAGAGGTGGG + Intronic
1056770543 9:89475194-89475216 AGAACCAGTGTCACAGAGGCTGG + Intronic
1056857059 9:90140623-90140645 AAAGCCAGGGCCCAGGAGGCAGG - Intergenic
1057206757 9:93178109-93178131 AAAGCCAGTGTCACCCTGGCTGG + Intergenic
1057322591 9:94028636-94028658 ATAGCCAGTGTCACATATGCTGG + Intergenic
1057555739 9:96086167-96086189 CAAGCAATTGTCCAAGAGGCAGG + Intergenic
1059757573 9:117308130-117308152 GAAGCCAGAGTCCCAGAGGAAGG - Intronic
1059972668 9:119683646-119683668 AAGGCCAATGTCACAGAGGCAGG + Intergenic
1060361282 9:122959853-122959875 AAAGCCTCTGTCCCAGGAGCAGG - Intronic
1061386144 9:130290312-130290334 AAAGCCAGTGACCCACAGGATGG - Intronic
1061391510 9:130319616-130319638 CCAGCCTGAGTCCCAGAGGCTGG - Intronic
1061547968 9:131315639-131315661 AAAGCCAGGCTCACAGGGGCAGG - Intergenic
1061627348 9:131848831-131848853 TATTCCAGAGTCCCAGAGGCTGG - Intergenic
1062610420 9:137371044-137371066 AAAGCCATTGTCCCCGAGCGGGG - Intronic
1062729110 9:138098671-138098693 AAAGCCAGAGTCTCAGAGCAGGG + Intronic
1185817371 X:3168816-3168838 AAAGCCCTTGTCCAAGAGGAGGG + Intergenic
1187279705 X:17848634-17848656 AAAGCCAGCCTCCCTGGGGCAGG - Intronic
1187393331 X:18900200-18900222 GACTCCAGTGTCCCAGAGGGGGG + Intronic
1187393862 X:18903649-18903671 AAAGCCAGGCTGCCAGGGGCTGG + Intronic
1188584085 X:31751367-31751389 AGAACCAGAGTCACAGAGGCAGG - Intronic
1189975948 X:46461465-46461487 AAAGCCAGCGTGCCAGAGGGTGG - Intronic
1189983119 X:46530235-46530257 AAAGCCAGTGTGCCAGAGGGCGG + Intronic
1190218227 X:48494003-48494025 AAAGCCATTGGCTCAGAGCCAGG - Intergenic
1190356379 X:49609397-49609419 AAAGTCAGTGTGTCAGAGCCAGG - Intergenic
1190629999 X:52376963-52376985 AAGGCCAGTGTGTAAGAGGCAGG - Intergenic
1190638869 X:52463732-52463754 AAGGCCAGTGTTTGAGAGGCAGG - Intergenic
1190680116 X:52819314-52819336 AAGGCCAGTGTTTGAGAGGCAGG - Intergenic
1190955549 X:55189617-55189639 AATGCCAGTGTGTGAGAGGCAGG + Intronic
1191746581 X:64495644-64495666 AAAGCCAGGGTCCCAGTATCAGG + Intergenic
1192156046 X:68747347-68747369 ATGGCCAGAATCCCAGAGGCAGG - Intergenic
1192198240 X:69046709-69046731 ATAGCCAGTGTGACAGAGTCTGG - Intergenic
1192234740 X:69288700-69288722 TCAGCAAGTGTCCCAGTGGCTGG + Intergenic
1197156136 X:123272348-123272370 AAAGCAAATGTCACTGAGGCGGG - Intronic
1197431344 X:126370136-126370158 AAAGCCAGTCCCCCAAATGCTGG - Intergenic
1197846777 X:130811289-130811311 AAAGCCTGAGTCCCAGGGGCTGG - Intronic
1200141939 X:153906832-153906854 AGAGCCTGTGGCCCCGAGGCTGG + Exonic
1200234844 X:154463332-154463354 GAAGACAGTGTCCCAGGTGCAGG + Intronic