ID: 1049409444

View in Genome Browser
Species Human (GRCh38)
Location 8:142465907-142465929
Sequence AGGAAAAGCCAGTGTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 319}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049409444_1049409450 19 Left 1049409444 8:142465907-142465929 CCTCTGGGACACTGGCTTTTCCT 0: 1
1: 0
2: 2
3: 37
4: 319
Right 1049409450 8:142465949-142465971 GCGCAGGAGCAGCGTCCTCGGGG No data
1049409444_1049409445 -9 Left 1049409444 8:142465907-142465929 CCTCTGGGACACTGGCTTTTCCT 0: 1
1: 0
2: 2
3: 37
4: 319
Right 1049409445 8:142465921-142465943 GCTTTTCCTGCTCATGAGACAGG No data
1049409444_1049409449 18 Left 1049409444 8:142465907-142465929 CCTCTGGGACACTGGCTTTTCCT 0: 1
1: 0
2: 2
3: 37
4: 319
Right 1049409449 8:142465948-142465970 TGCGCAGGAGCAGCGTCCTCGGG No data
1049409444_1049409447 3 Left 1049409444 8:142465907-142465929 CCTCTGGGACACTGGCTTTTCCT 0: 1
1: 0
2: 2
3: 37
4: 319
Right 1049409447 8:142465933-142465955 CATGAGACAGGAGCGTGCGCAGG No data
1049409444_1049409448 17 Left 1049409444 8:142465907-142465929 CCTCTGGGACACTGGCTTTTCCT 0: 1
1: 0
2: 2
3: 37
4: 319
Right 1049409448 8:142465947-142465969 GTGCGCAGGAGCAGCGTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049409444 Original CRISPR AGGAAAAGCCAGTGTCCCAG AGG (reversed) Intronic
901812790 1:11777293-11777315 AGGAGAAGCCAGCTTCCCGGAGG + Intronic
902542035 1:17162646-17162668 AGGACTGGCCAGTCTCCCAGAGG + Intergenic
903064854 1:20693692-20693714 AGCAAAAGCCAAAGCCCCAGGGG - Intronic
903065555 1:20697295-20697317 AGGAAAAGCCAGGGTTCTAAAGG + Intronic
903337821 1:22636701-22636723 AGGTGAGGCCAGAGTCCCAGAGG + Exonic
903545509 1:24121264-24121286 AGGACTAGAAAGTGTCCCAGTGG + Exonic
905315228 1:37078695-37078717 AGCAAAAGCCAGAGTCGGAGAGG + Intergenic
906103279 1:43276689-43276711 AGGAAAAGGCAGTGTCACTGAGG - Intergenic
906608386 1:47186462-47186484 AGGAAACCCCAGTGGCTCAGTGG - Intronic
906939133 1:50240328-50240350 AGGAAAGGCCATTGTCACAGTGG - Intergenic
907297621 1:53465368-53465390 AGGATCATCCAGTGCCCCAGTGG - Intronic
907748891 1:57243374-57243396 GGGAAAAGCCACAGTCCCATAGG - Intronic
908903509 1:68982769-68982791 ACGAAAAGCCAAAGACCCAGGGG + Intergenic
909973933 1:82023278-82023300 AGGAAGACCCAGTGTCACACTGG - Intergenic
910659204 1:89652705-89652727 AAAGAAAGCCACTGTCCCAGAGG + Intronic
911041332 1:93593252-93593274 AGAAAAAGGCTGTGTCCCTGTGG + Intronic
911046295 1:93631495-93631517 AGGGAAAGCCAGGGTGGCAGAGG + Intronic
911189100 1:94929969-94929991 AGGGAAAGGCAGTCTCCCAATGG - Intergenic
912745889 1:112244851-112244873 AGGAAAAGCCAAGGCCCCTGGGG + Intergenic
914859815 1:151376612-151376634 ATCAGAAGCCTGTGTCCCAGTGG + Intergenic
915245635 1:154554578-154554600 AGGAATAGCCAGTGTAGTAGAGG - Intronic
916322236 1:163517658-163517680 AAGAAAAGCCAGGGACCCAATGG + Intergenic
916533744 1:165683026-165683048 AGGAAATGTCAATGTCCAAGCGG + Exonic
917981453 1:180272110-180272132 AGGAAAAGCCTGTGTTCAGGAGG - Intronic
918566415 1:185938680-185938702 AGCAGAAGCAAATGTCCCAGTGG + Intronic
919198344 1:194317757-194317779 AGGAAAAAGCAGTTGCCCAGAGG + Intergenic
919269626 1:195322874-195322896 AAGAAAAGCCAGGGACCCAATGG - Intergenic
919760070 1:201092152-201092174 TGGAAAAGCCACTGCCCCAGTGG + Intronic
919901473 1:202046999-202047021 AGGCAGAGCCTGTGTCCCAGAGG + Intergenic
921211587 1:212904566-212904588 AAGAAAAACCAAAGTCCCAGTGG + Intergenic
921314042 1:213874068-213874090 AGGAAAAGCCAGGTCCCAAGAGG + Intergenic
924440992 1:244085231-244085253 AGGAAAAGCTCATTTCCCAGAGG + Intergenic
924563624 1:245177805-245177827 AGGAAAAACCAGGGTTCCAGAGG - Intronic
1063031614 10:2240769-2240791 AGGATTCTCCAGTGTCCCAGGGG + Intergenic
1064970430 10:21060611-21060633 AGGAGGAACCAGTGTTCCAGGGG - Intronic
1065856801 10:29837869-29837891 AGGCAAGGCCAGGGTCACAGCGG + Intergenic
1065933813 10:30502795-30502817 GGGAAAAGACAGTGTCCCCAGGG - Intergenic
1066437987 10:35411896-35411918 AGGAAAAGCCAGTGAGACAGTGG - Intronic
1067167900 10:43879877-43879899 AGGAAAAGCCCGTGGTCCCGTGG + Intergenic
1068251775 10:54452355-54452377 AGAGAAAGCCAGTGTCTAAGGGG - Intronic
1069590921 10:69641380-69641402 AGGAAAAGCAAGTGCAGCAGAGG - Intergenic
1071573077 10:86708569-86708591 AGGAAGAGACAGTGTCCAAGGGG - Intronic
1072629403 10:97135096-97135118 AGGAAAAGCCAGAGGCCTACGGG + Intronic
1074408812 10:113205601-113205623 AAGAAAAGCCCAGGTCCCAGTGG + Intergenic
1075001608 10:118802708-118802730 AGGCACAGCCTGTGTCCTAGGGG + Intergenic
1076484825 10:130809223-130809245 AGGACATTCCTGTGTCCCAGGGG + Intergenic
1076608927 10:131708277-131708299 AGGAAGAGAAAGAGTCCCAGGGG + Intergenic
1076754896 10:132564266-132564288 AGGGAAGGCGAGGGTCCCAGGGG + Intronic
1076804039 10:132846353-132846375 AGGAGGAGCCAGCATCCCAGGGG - Intronic
1077981860 11:7308952-7308974 AGGAAAGGCCAGAATCCCAGAGG - Intronic
1078371625 11:10751268-10751290 AGGAGAAGCCAGAGCTCCAGCGG + Exonic
1078438297 11:11343708-11343730 AGCAATAGCCACTGTTCCAGTGG - Intronic
1079107313 11:17579743-17579765 AGGAAAAGCCAGGGTGTCTGGGG + Intronic
1079338317 11:19590488-19590510 ATTAAAAGCAATTGTCCCAGAGG + Intronic
1082821618 11:57547881-57547903 AGGAGAAACCAGGGCCCCAGAGG - Intronic
1084402058 11:68950326-68950348 AGGAAAGGCCAGATTTCCAGTGG + Intergenic
1085419720 11:76345483-76345505 AGCAAATGCCAGTTTCTCAGTGG + Intergenic
1087051285 11:93888789-93888811 AAGAAATCCCAGTGTCCCTGAGG - Intergenic
1088364983 11:109031147-109031169 AGGACAAGCCAGGCTCCCTGTGG + Intergenic
1089387578 11:118078351-118078373 AGGAGAAGCCACTGTCCAAGGGG + Intronic
1091265442 11:134267535-134267557 AGGAAAAGCCTGTGTGTCAGGGG + Intergenic
1091343110 11:134835304-134835326 AGGGAAAGCCAGAGGCCCTGAGG - Intergenic
1091560864 12:1612101-1612123 AGGCAAAGCCAGCGTCCCCCTGG + Intronic
1092297207 12:7210062-7210084 AGGAAAAGCCGGGGCCCCCGGGG + Exonic
1093539472 12:20264647-20264669 AGGCAAAGGAAGTGTCCTAGAGG - Intergenic
1093847183 12:23987350-23987372 AGTACACTCCAGTGTCCCAGTGG + Intergenic
1095139042 12:38640063-38640085 AGGCCATGCCAGTGTCCAAGAGG - Intergenic
1096596631 12:52700022-52700044 AGGCCAGGCCAGTGTCCCAGGGG + Intronic
1096972874 12:55681707-55681729 GGAAAAAGCCAGTGCCCCAGCGG + Exonic
1098150054 12:67537486-67537508 GAGAAAGGCCAGTGCCCCAGAGG - Intergenic
1101785050 12:107875230-107875252 AGGAAAAGCCAATACCCAAGAGG - Intergenic
1101967736 12:109292462-109292484 AGGTTAAGCCAGTGGCCCAAGGG - Intronic
1102477519 12:113198312-113198334 AGGAAAAGGCTGTGTCACAGAGG + Intronic
1102626813 12:114241867-114241889 AGGGAAGGGCAGTTTCCCAGAGG - Intergenic
1104413309 12:128577467-128577489 TGGAAAAGCGAGTGTCACCGGGG - Intronic
1104496938 12:129249811-129249833 TGGATCAGCCAGGGTCCCAGTGG + Intronic
1104566485 12:129889466-129889488 AGGTAATGCCGGTGTCTCAGTGG - Intronic
1105985141 13:25558596-25558618 AGGAAACTCCAGTTTCTCAGTGG - Intronic
1107004898 13:35598408-35598430 GGGCAAAGCCAATGTCCCAGAGG - Intronic
1107192116 13:37601586-37601608 AGAAAAAGACAGTGACCCTGGGG + Intergenic
1108497144 13:51036170-51036192 AGGAAAAGCAGGGGTCCCAGCGG + Intergenic
1108558532 13:51620469-51620491 AGGATAAGACAGAGACCCAGAGG - Intronic
1108888772 13:55226500-55226522 AGGAAGAGCCAGAGTGACAGAGG + Intergenic
1111713747 13:91851198-91851220 AGATACAGCCAGTGCCCCAGAGG + Intronic
1113790973 13:113027951-113027973 AGGAAGGGCCTGTGTCCCAGGGG + Intronic
1114646759 14:24260328-24260350 AGGAGAAGCCAGCCTCCCATTGG - Intronic
1115458352 14:33631522-33631544 GGGAAGAGCACGTGTCCCAGTGG + Intronic
1115521170 14:34234418-34234440 TTGCACAGCCAGTGTCCCAGAGG + Intronic
1115770978 14:36663600-36663622 TGGGAAAGACAGTGTCCCTGAGG - Intronic
1115918740 14:38347352-38347374 AAGAAAAGCCTGAGACCCAGTGG + Intergenic
1116152795 14:41163694-41163716 AGGAAGAACCAGGGTCCAAGCGG - Intergenic
1116173550 14:41433749-41433771 AGTAAAAGCCAGTGAAACAGTGG + Intergenic
1116708520 14:48335081-48335103 AGGGAAAGCCTGTCTCCCAATGG + Intergenic
1117522814 14:56567570-56567592 GAGAAAAGCCAGTTTCCCACTGG + Intronic
1118256822 14:64212595-64212617 TGGAAAAGCCAGTGCCCGTGAGG + Intronic
1119183372 14:72619170-72619192 AGGAAAAGAAATAGTCCCAGAGG - Intergenic
1119424109 14:74524771-74524793 TGGAAGAGCCAGGATCCCAGTGG + Intronic
1119635743 14:76271857-76271879 AGAGAAAGCCAGAGGCCCAGAGG - Intergenic
1119749868 14:77069652-77069674 AGGAGAAGCCCATGCCCCAGGGG + Intergenic
1120296403 14:82647365-82647387 AGGAAAAGGCAGTCTCCCAAAGG + Intergenic
1120721557 14:87894612-87894634 AGGAAAAGCAATTTTCCCAACGG - Intronic
1122477155 14:102018380-102018402 AGGAAGGGGCAGTGTGCCAGTGG - Intronic
1122958781 14:105085069-105085091 AGGGCAGGCCTGTGTCCCAGGGG - Intergenic
1122979239 14:105184189-105184211 AGGAAAAACCAGTGTCACTGAGG + Intergenic
1124118077 15:26866632-26866654 AGGGAAAGCCAGGGTCACATTGG - Exonic
1124632965 15:31347676-31347698 AGGAAAAGTGGGTGTCACAGTGG + Intronic
1127846181 15:62873514-62873536 AGGAGAAGCCAGTGTTTGAGAGG + Intergenic
1128368405 15:67021475-67021497 AGGAAAAGTCAGTCTCCCAAAGG + Intergenic
1128908917 15:71494441-71494463 ATTAAAAGCCAGTGTCCTATTGG - Intronic
1129266549 15:74396464-74396486 AGGAAAAGCCAGCCCCTCAGAGG + Intergenic
1129298163 15:74611081-74611103 AGGAAGGGCCAGGGTCCCTGTGG - Intronic
1129665692 15:77578274-77578296 AGGAAACATCTGTGTCCCAGTGG + Intergenic
1129689835 15:77706894-77706916 AGCTATAGCCAGAGTCCCAGAGG + Intronic
1129716027 15:77851449-77851471 AGGCAATGCCAATGCCCCAGGGG + Intergenic
1130042869 15:80419475-80419497 AGGGAAAGCCAGTGTGACAGTGG - Intronic
1130648851 15:85750916-85750938 AGGGAAAGCCCGTGGCCTAGGGG + Intergenic
1130649209 15:85752525-85752547 AGGGAAAGCCCGTGGCCTAGGGG - Intergenic
1130861189 15:87891832-87891854 AGCAACAGCCACTGTCCCATGGG + Intronic
1131215715 15:90533686-90533708 AGCAAAACACAGTGTCCCAGTGG + Intronic
1131671062 15:94619928-94619950 AGAAGGTGCCAGTGTCCCAGTGG + Intergenic
1132809258 16:1789799-1789821 AGGACCAGGCAGTGTCCCCGAGG - Intronic
1133400493 16:5482780-5482802 AGGAAAAGCCGTTTGCCCAGAGG - Intergenic
1135397800 16:22144549-22144571 AAGAAAAGCCAACTTCCCAGAGG + Intronic
1137905758 16:52320335-52320357 AGGAACAGCCAATGGACCAGTGG - Intergenic
1138343915 16:56308517-56308539 CTGAAAGGCCAGTGACCCAGAGG + Intronic
1139044378 16:63038847-63038869 AGGAAAAGACAGTATCCCTCTGG + Intergenic
1141494950 16:84402901-84402923 AGGAAAAGCCCAGGACCCAGTGG - Intronic
1141735312 16:85848261-85848283 AGGGAGAGCCAGTGTCCATGCGG + Intergenic
1142237556 16:88929391-88929413 AAGAAAAGCCACTGTCCTGGTGG - Intronic
1143696992 17:8628896-8628918 ATGAAAAGCCAGGCTCGCAGGGG + Intronic
1143938572 17:10513639-10513661 AGCAGAAGCCAGTTTCCCTGTGG + Exonic
1146815217 17:35936944-35936966 AGGCAAAGGCTGTCTCCCAGGGG + Intronic
1147253232 17:39165915-39165937 ACGAAGGGCCAGCGTCCCAGAGG - Intronic
1147977210 17:44254723-44254745 AGGAGGAGCCAGGGTCCTAGGGG + Intronic
1148476638 17:47933041-47933063 AGGAAAGGTCAGTGTGTCAGGGG - Intergenic
1149437001 17:56641507-56641529 AAGTAAGGGCAGTGTCCCAGTGG + Intergenic
1150146612 17:62774532-62774554 AGGAAAAGCCAGCTTCACTGCGG + Intronic
1150226389 17:63526895-63526917 AGGAAGAGCCAGTTTCCCAGGGG - Intronic
1151392601 17:73797738-73797760 AGGAATGGCCAGGGGCCCAGAGG + Intergenic
1155062154 18:22238168-22238190 AGGGACAGACAGTGGCCCAGGGG + Intergenic
1155547397 18:26929640-26929662 AGCAAAAGACACTGTCCAAGTGG + Intronic
1157060930 18:44289473-44289495 AGGAGAAGCCAATTTCCCTGGGG + Intergenic
1157922491 18:51727634-51727656 AGGGAAAGCCTCTGTCCCACTGG + Intergenic
1158606550 18:58901125-58901147 AGGAAAAGAAAGAGACCCAGAGG - Intronic
1159210866 18:65319338-65319360 AGTTAAGGCCAGTGTGCCAGTGG - Intergenic
1160211756 18:76886829-76886851 AGCAAAAGCCAGTATCTTAGAGG + Intronic
1160451950 18:78972473-78972495 AGGAAAGGACGGTGTCACAGGGG - Intergenic
1162063210 19:8109329-8109351 AGGAAATGCCACTGTCCCCTCGG + Exonic
1163715707 19:18870832-18870854 AGGAAGTGCCAGGGTGCCAGGGG - Intronic
1164237226 19:23347776-23347798 AGGAAAAGGCAGTGGCCAAAGGG - Intronic
1166271379 19:41716390-41716412 AGGCAAGGCCAGTCACCCAGGGG - Intronic
1168069527 19:53942005-53942027 AGGCAAGGTCAGAGTCCCAGGGG - Intronic
928175041 2:29027815-29027837 AGGCAAAGCAAATGTCACAGAGG + Intronic
929284035 2:40115445-40115467 AGAGAAAGCTAGTGTGCCAGGGG + Exonic
929635315 2:43513538-43513560 AGGAAAAGCCAAGGGCACAGGGG + Intronic
930919744 2:56738221-56738243 AGGAATAGGCAGTGTCTCTGTGG - Intergenic
932286233 2:70534417-70534439 AGGTGAAGCCAGTGCCCCAGGGG + Intronic
933715571 2:85357399-85357421 AGGAAAAGCAATTGACCCTGAGG - Intronic
934568007 2:95351201-95351223 AGTAAAAGCCAATGTCCTTGCGG - Intronic
934883702 2:98006169-98006191 AGAACAAGCCTGTGTGCCAGAGG - Intergenic
936837736 2:116728081-116728103 AGGGAAAGGCAGTCTCCCAATGG + Intergenic
937794259 2:125998390-125998412 GGTAGAAGCCACTGTCCCAGAGG + Intergenic
937969634 2:127539419-127539441 GGCAAAAGCCAGTTTCCAAGGGG + Intronic
939404856 2:141743582-141743604 AAGAAAAGCCTGGGACCCAGTGG - Intronic
944076140 2:195733229-195733251 AGCAAAACGTAGTGTCCCAGAGG + Intronic
944370344 2:198974712-198974734 AGGTAAATACAGTGCCCCAGTGG - Intergenic
946126518 2:217567767-217567789 AGGCACAGCCTGTGTCCCAGGGG - Intronic
946764646 2:223029269-223029291 AGGAAAAGCCACCTTCTCAGTGG - Intergenic
947104443 2:226653926-226653948 AGAAAATCCCAGTTTCCCAGAGG - Intergenic
1169737821 20:8856060-8856082 ATGAAAGGCCAGGGTACCAGAGG - Intronic
1170143456 20:13148128-13148150 AGGACAACTCAGTCTCCCAGAGG - Intronic
1170236380 20:14109770-14109792 AAGAAAAGCCTGGGACCCAGTGG + Intronic
1170869364 20:20190761-20190783 AGGAAAAGCCAGTTTCACTAAGG + Intronic
1171240730 20:23565339-23565361 AGGAGAATGCATTGTCCCAGTGG + Intronic
1171968442 20:31548398-31548420 AGGAAAGGCCGGAGTCCCCGAGG - Intronic
1172194116 20:33080377-33080399 AGCAAAAGAAAGTTTCCCAGAGG + Intronic
1173219693 20:41121853-41121875 TCGAAAAGCCAGGGCCCCAGGGG - Intronic
1174615045 20:51829016-51829038 GGGAAAAGCCAGGGAGCCAGGGG - Intergenic
1175468002 20:59205541-59205563 AGGAAAAACCAGTGCCCAAGAGG + Intronic
1175549596 20:59808573-59808595 AGGGAGAGACAGTGCCCCAGGGG + Intronic
1176309925 21:5144146-5144168 AAGCAAAGCCAGTGACCAAGAGG + Exonic
1178728591 21:35078416-35078438 AGGAAAAGACACAGACCCAGAGG - Intronic
1179373331 21:40827110-40827132 AGGAGAAGCCAGTGAGGCAGAGG + Intronic
1179847131 21:44117886-44117908 AAGCAAAGCCAGTGACCAAGAGG - Exonic
1179972956 21:44846508-44846530 AATAAAAGCCCGTGTCACAGAGG - Intergenic
1180085021 21:45504575-45504597 AGGCAGAGCCCATGTCCCAGGGG + Intronic
1180793912 22:18592551-18592573 AGGAAAGGTCAGTTTTCCAGGGG + Intergenic
1181227828 22:21402769-21402791 AGGAAAGGTCAGTTTTCCAGGGG - Intergenic
1181250824 22:21532070-21532092 AGGAAAGGTCAGTTTTCCAGGGG + Intergenic
1183431665 22:37769468-37769490 AGGAAAGCCAAGTCTCCCAGTGG + Intronic
1183497580 22:38157479-38157501 AAGAAAAGCCTGGGACCCAGTGG + Intronic
1185322341 22:50207556-50207578 AGGAAAAGCCAGAGGCCCACAGG - Intronic
950522383 3:13504887-13504909 AGGCAGAGCCTGTGTCCCAGGGG + Exonic
950728911 3:14939252-14939274 AGGAACAGCCAGAGAGCCAGAGG - Intergenic
951558993 3:23946722-23946744 AGGAAAAGTCAGCGACCCACAGG - Intronic
952001780 3:28794145-28794167 AGGAAAAGTCAGTGTCCAGTGGG - Intergenic
952811361 3:37406767-37406789 AGGGAAAGCCAGGGACCCAATGG - Intronic
953568331 3:44051871-44051893 GGGGAAAGCTAGTGTCTCAGAGG - Intergenic
954140230 3:48601143-48601165 AGGAACAGCCAGACTGCCAGGGG + Intronic
954291339 3:49651593-49651615 AGGAATAGCCTGTGTCACTGAGG - Exonic
956046780 3:65204003-65204025 AGTAAATGGCAGTGGCCCAGAGG + Intergenic
957328558 3:78728996-78729018 AGAAAAAGCAATTATCCCAGTGG + Intronic
958477010 3:94597321-94597343 AGGCCAAGCCCGTGTCTCAGAGG - Intergenic
960164492 3:114386156-114386178 ACGATAAGCCAGAGTCCCATAGG - Intronic
960583902 3:119303373-119303395 AGGAAAAGGCAGTGTTTCTGGGG - Intronic
961039852 3:123670349-123670371 AGGAATAGACAGTGGCTCAGAGG + Intronic
962043403 3:131731164-131731186 AGCAGAACCCAGTGTGCCAGAGG - Intronic
962462214 3:135624864-135624886 AGGAAAAGCACCTGTGCCAGAGG + Intergenic
962751828 3:138439358-138439380 AGGAAAAGCCAGGGTGCAGGGGG - Intronic
962976059 3:140446823-140446845 AGGAAAAGCCAGTGATAGAGAGG - Intronic
963064615 3:141253331-141253353 AGGGAAAGCCAGCTGCCCAGAGG - Intronic
963266703 3:143246919-143246941 AGGAACCACCTGTGTCCCAGAGG + Intergenic
963330844 3:143913852-143913874 AAGAAAAGCCAAGGACCCAGTGG + Intergenic
964396075 3:156247513-156247535 AGGACAGGCCAGATTCCCAGAGG - Intronic
964789931 3:160444469-160444491 TGGAAATTCCAGTCTCCCAGAGG - Intronic
965312268 3:167144452-167144474 AGAAAAAGCCTGAATCCCAGAGG + Intergenic
966556620 3:181268877-181268899 AGGAAAAGCCAATTTAGCAGAGG - Intergenic
967413729 3:189194631-189194653 GGGAAAAGGGAGTGTCCTAGAGG + Intronic
968121910 3:196131829-196131851 AGGAACAGCCAGGAGCCCAGTGG + Intergenic
969274054 4:6123270-6123292 AGGCAAAGCCCCCGTCCCAGGGG + Intronic
969681308 4:8644908-8644930 AGGAAATGCCAGTAACCCTGGGG - Intergenic
969802891 4:9583516-9583538 AAGAAAAGCCAGCATCACAGGGG + Intergenic
973327094 4:48873619-48873641 AAGAAAAGCCCGAGACCCAGTGG - Intergenic
973849642 4:54948442-54948464 AGAAAAAGCCAGTGGCCAAGGGG - Intergenic
974420118 4:61662590-61662612 AGGAACAGCCTATGTCCCATGGG + Intronic
975372926 4:73608881-73608903 ACAAAGAGCCAGTGTTCCAGAGG - Intronic
976592556 4:86863568-86863590 AGGAAAGGCCAGTTTCTCTGGGG + Intergenic
977073442 4:92422512-92422534 AGGGGAAGCCAGTGAGCCAGCGG + Intronic
977985967 4:103383916-103383938 AGGAAAAGCCTGGGACCCAATGG + Intergenic
978887798 4:113785822-113785844 TGCACAAGCCAGGGTCCCAGAGG + Intergenic
978957351 4:114630828-114630850 CTGAAAAATCAGTGTCCCAGAGG - Intronic
980497106 4:133600258-133600280 AGGAAAAGCCAGTGAGCCAGGGG - Intergenic
983574464 4:169245990-169246012 AGGAAAACACAGTCTGCCAGGGG + Intronic
984155911 4:176195747-176195769 AGGCAAAGCTGGGGTCCCAGTGG + Intergenic
984401667 4:179273518-179273540 AGGAAAAGCCACAGACACAGGGG + Intergenic
984577289 4:181465895-181465917 AGGAAGAGCAAGTGGCACAGTGG - Intergenic
984833655 4:183999487-183999509 AGGATAAGACGTTGTCCCAGTGG - Intronic
985578459 5:684505-684527 AGCAAAAGCCACTCTCACAGCGG + Intronic
985695707 5:1338949-1338971 TGGATGAGCCAGTGTCCCACTGG - Exonic
985825452 5:2187680-2187702 AGGAAACGCTAGATTCCCAGTGG + Intergenic
985849249 5:2376608-2376630 AGGATAAGCCATTGGCCCTGTGG + Intergenic
985878821 5:2621841-2621863 AGGAAGGGTCAGTGTCACAGAGG - Intergenic
989215150 5:38897266-38897288 AAGAAAAGCCTGGGACCCAGTGG - Intronic
990380651 5:55219763-55219785 AGGAAAAGGCAGATTCTCAGAGG - Intronic
992309873 5:75485879-75485901 AAGAAAAGCCTGAGACCCAGTGG + Intronic
995190141 5:109311046-109311068 AGAAAAAGCCAGTGTGGCTGGGG - Intergenic
995706540 5:114993661-114993683 AGGCAATGCTAGTGTCCAAGAGG - Intergenic
996647844 5:125838689-125838711 AGGAAAAGTCAGTTTTCTAGGGG - Intergenic
996808534 5:127486577-127486599 TGGCAAAGCCAGTGCCACAGAGG - Intergenic
997280545 5:132641377-132641399 AGAAAAAGGCAGTTTCCCTGAGG + Intronic
997589131 5:135062314-135062336 AGGAAAAGCCCCTGCCCCCGGGG - Intronic
997974006 5:138428158-138428180 AGGAAAAGCCACTGGCCCTAAGG - Intronic
998038572 5:138936671-138936693 AGTAAAAGCCAGAGTCCTAAAGG + Intergenic
999428013 5:151504302-151504324 ATGAAAAGGCAGTGGACCAGAGG + Exonic
999629310 5:153553786-153553808 AGGGAAAGGCAGTTTCCCAATGG - Intronic
1000339484 5:160266270-160266292 AAGGGAGGCCAGTGTCCCAGGGG + Intronic
1001534153 5:172486836-172486858 TGGGAAAGCCAGGGTCCCAGAGG + Intergenic
1001940688 5:175737458-175737480 ACGAAAAGCCAGGGTCCAGGAGG + Intergenic
1002055903 5:176597759-176597781 AGGGAGAGCCTGTGTCCCTGGGG - Exonic
1003530636 6:6934720-6934742 AGGACAAGCCACTGTATCAGAGG + Intergenic
1004545953 6:16598602-16598624 GGGGAAAACCAGTGTCCGAGTGG - Intronic
1004730181 6:18350256-18350278 AGGAAAAGCAAGTGAGCAAGTGG - Intergenic
1005862340 6:29911219-29911241 AGGAAAGGCCAGGGGCCCACAGG - Intergenic
1006633532 6:35446254-35446276 GGGACAAGCCAGAGGCCCAGCGG + Intergenic
1006652712 6:35564892-35564914 AGGAAAAGACAGAGAGCCAGAGG - Intergenic
1006730272 6:36231021-36231043 TGGATACGCCAGGGTCCCAGGGG + Exonic
1006799056 6:36747973-36747995 AGGAACACCCAGTCTCCCTGGGG - Intronic
1010146324 6:72673584-72673606 AGGCAAAGGCAGTGACCCATGGG + Intronic
1010168418 6:72944657-72944679 AGGAAAGGCCAGTGACACAGAGG - Intronic
1011079601 6:83474924-83474946 AGGAAAAAGCAGTATCCTAGAGG + Intergenic
1011223659 6:85084244-85084266 AGGAAGAGGCAGTGACCCACTGG - Intergenic
1011447362 6:87455880-87455902 AAGAAAAGCCAGGGACCCAGTGG + Intronic
1018244783 6:161812373-161812395 AGCAAAAGCCTGTGTCCAAAAGG + Intronic
1021780807 7:24103746-24103768 AGGAAAAGAGAGTGTGGCAGAGG + Intergenic
1022067519 7:26874785-26874807 AGGCAGAGCCAGAGTCCAAGAGG - Intronic
1022739252 7:33105831-33105853 AGGAAGACCCAGAGACCCAGAGG - Intronic
1022740778 7:33118968-33118990 AGGAAAAGCCCAAGACCCAGTGG - Intergenic
1023553309 7:41391988-41392010 AGGAAAGGCCTCTGTCCCTGGGG - Intergenic
1023849069 7:44140407-44140429 AGGGAAGGTGAGTGTCCCAGAGG - Exonic
1023860061 7:44213135-44213157 AGTCAAGGCAAGTGTCCCAGAGG - Exonic
1023899115 7:44461463-44461485 AGGAAAAGGCTGTCTCCCTGTGG + Intronic
1023966578 7:44966011-44966033 GGGGAAAGCTTGTGTCCCAGGGG - Intronic
1026193166 7:68148109-68148131 AGGAAAAGCCAGGGTGACACAGG - Intergenic
1029590905 7:101506487-101506509 AGCCAGAGCCACTGTCCCAGGGG - Intronic
1031368085 7:120927736-120927758 GGGATAAGCCAGTCTCCCAAAGG + Intergenic
1031996798 7:128238009-128238031 AGGAAAAGCCAGGATCACACAGG - Intergenic
1032202539 7:129832258-129832280 AGCAAAAGTCAGTTTCCCAGTGG + Exonic
1032785427 7:135196301-135196323 ACCAGAAGCCAGTGGCCCAGAGG - Exonic
1034466871 7:151235022-151235044 TGGAAAGACCAGTGTGCCAGAGG - Intronic
1034877692 7:154739823-154739845 GAGAAACCCCAGTGTCCCAGAGG + Intronic
1034924985 7:155114047-155114069 AAGAAACCCCACTGTCCCAGGGG + Intergenic
1034994677 7:155570489-155570511 AGGGAAAGACGGTGGCCCAGTGG + Intergenic
1035916342 8:3628603-3628625 AGGAAGAGGGAGTGTCTCAGAGG + Intronic
1036252102 8:7171150-7171172 AAGAAAAGCCAGCATCACAGCGG - Intergenic
1036365389 8:8116311-8116333 AAGAAAAGCCAGCATCACAGCGG + Intergenic
1036746832 8:11415698-11415720 AAGAACAGCCAGAGTCCCAAGGG - Intronic
1038483473 8:27917844-27917866 AGGAAAAGCTAAGATCCCAGGGG + Intronic
1039312109 8:36327961-36327983 AGGAAAAGCCAGAGACTAAGAGG - Intergenic
1040521961 8:48185081-48185103 TCCAAAAGCAAGTGTCCCAGTGG + Intergenic
1040781189 8:51111546-51111568 AGGATGAGCAAGTTTCCCAGTGG + Intergenic
1041958384 8:63582793-63582815 GGGGAAGGGCAGTGTCCCAGTGG + Intergenic
1044171440 8:89057375-89057397 AGGAAAAGCCAGAGCTGCAGTGG - Intergenic
1045078054 8:98592621-98592643 AGACAAAGACAGTGTCCTAGAGG - Intronic
1047203284 8:122783299-122783321 CCTAAAAGGCAGTGTCCCAGGGG - Intronic
1048063791 8:130947901-130947923 AGGAAAAGCCATTGAGCCAGAGG + Intronic
1048251505 8:132869926-132869948 AGGAGAAGCCAGCAGCCCAGAGG - Intronic
1048562546 8:135556948-135556970 ACAAAAAGCCTGTGTCCCTGTGG + Intronic
1049040053 8:140105721-140105743 ACAAAAAGAAAGTGTCCCAGAGG - Intronic
1049409444 8:142465907-142465929 AGGAAAAGCCAGTGTCCCAGAGG - Intronic
1049798650 8:144507735-144507757 AGGATAAGGGAGCGTCCCAGGGG + Intergenic
1050204848 9:3185844-3185866 AGGGAACGGCAGTCTCCCAGTGG + Intergenic
1050357156 9:4793691-4793713 AGGAACAGCCGGTGTCCAAGGGG - Intronic
1050478468 9:6064974-6064996 AGGGAAAGGCAGTGTCTTAGAGG + Intergenic
1050592541 9:7175020-7175042 AGGAAAAGCCACTGCCACAGAGG + Intergenic
1050636602 9:7619259-7619281 AGGAAAAGACAGTTTGCCAATGG + Intergenic
1051047546 9:12893067-12893089 AAGAAAAGCCTGGGACCCAGTGG + Intergenic
1051194353 9:14547038-14547060 GGGAATAGGCAGTGTCCCAGTGG + Intergenic
1053165673 9:35842073-35842095 TGGCAAGGACAGTGTCCCAGAGG - Intronic
1055752997 9:79527929-79527951 AGGAAAAGCCACTGGCAGAGAGG - Intergenic
1059004250 9:110384045-110384067 AGGAACAGCCACTGTCACTGTGG - Intronic
1059635651 9:116168031-116168053 AGGAAAATAAAGTGACCCAGTGG - Intronic
1059685917 9:116635883-116635905 AGCAAAACCCAGTTTCCAAGGGG + Intronic
1060954652 9:127629832-127629854 TGTAAATGCCAGTGTCCCACGGG - Intronic
1060991103 9:127849634-127849656 AGGTAAAGGCAGGGTCCCAGGGG + Intronic
1188983422 X:36748997-36749019 GGGAAAAACCAGTCTACCAGTGG - Intergenic
1189683934 X:43544392-43544414 AGGGAAAGGCAGTCTCCCAATGG - Intergenic
1189983117 X:46530231-46530253 CAGGAAAGCCAGTGTGCCAGAGG + Intronic
1190331347 X:49237347-49237369 AGGAAAGGCAAGTGTTGCAGAGG - Intronic
1190331349 X:49237367-49237389 AGGAAAGGCAAGTGTTGCAGAGG - Intronic
1190978933 X:55437680-55437702 AAGAAAAGCCAGTGACCCCATGG + Intergenic
1191829916 X:65406016-65406038 AAGAAAAGCTAGGGACCCAGTGG + Intronic
1191972801 X:66836241-66836263 AAGAAAAGCCTGGGACCCAGTGG + Intergenic
1192585261 X:72314021-72314043 GTGAAAAGCCAGTGTCCCCCAGG - Intergenic
1192700467 X:73465053-73465075 AGGAAAAGCCCAGGTCCCAATGG - Intergenic
1193631532 X:83894324-83894346 AAGAAAAGCCTGGGGCCCAGTGG - Intergenic
1193691631 X:84652768-84652790 AGGAAAAGCCCAAGACCCAGTGG - Intergenic
1195238920 X:102931929-102931951 AGGAAAAGACAGAGTCAAAGAGG + Intergenic
1195623760 X:106986153-106986175 AAGAAGAGCCAGTGTCCCATTGG - Exonic
1195789858 X:108572146-108572168 AGGAAAGGATAGTGTCACAGAGG - Intronic
1196950730 X:120874220-120874242 AGGGAAATACAGTGTCCCTGTGG - Intronic
1196951423 X:120879124-120879146 AGGGAAATACAGTGTCCCTGTGG - Intronic
1196951565 X:120930613-120930635 AGGGAAATACAGTGTCCCTGTGG - Intronic
1196952249 X:120935474-120935496 AGGGAAATACAGTGTCCCTGTGG - Intronic
1196952934 X:120940335-120940357 AGGGAAATACAGTGTCCCTGTGG - Intronic
1196953619 X:120945195-120945217 AGGGAAATACAGTGTCCCTGTGG - Intronic
1196954304 X:120950056-120950078 AGGGAAATACAGTGTCCCTGTGG - Intronic
1196954987 X:120954916-120954938 AGGGAAATACAGTGTCCCTGTGG - Intronic
1196955676 X:120959799-120959821 AGGGAAATACAGTGTCCCTGTGG - Intronic
1196956357 X:120964660-120964682 AGGGAAATACAGTGTCCCTGTGG - Intronic
1196957039 X:120969520-120969542 AGGGAAATACAGTGTCCCTGTGG - Intronic
1196957721 X:120974380-120974402 AGGGAAATACAGTGTCCCTGTGG - Intronic
1196958403 X:120979240-120979262 AGGGAAATACAGTGTCCCTGTGG - Intronic
1196959084 X:120984100-120984122 AGGGAAATACAGTGTCCCTGTGG - Intronic
1197670221 X:129268904-129268926 ATGAAAAGCCCGGGACCCAGTGG - Intergenic
1200938175 Y:8756542-8756564 AGGATCAGTCAGTGTCTCAGAGG + Intergenic
1201275110 Y:12289455-12289477 AGAAAAAGACAGTGACACAGAGG + Intergenic
1202151221 Y:21845351-21845373 AGGTTAAGACAGTGTCTCAGAGG + Intergenic
1202181746 Y:22145648-22145670 AGGATGAGACAGTGTCTCAGAGG + Intergenic
1202209614 Y:22440754-22440776 AGGATGAGACAGTGTCTCAGAGG - Intergenic