ID: 1049409446

View in Genome Browser
Species Human (GRCh38)
Location 8:142465927-142465949
Sequence CACGCTCCTGTCTCATGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 104}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049409446_1049409448 -3 Left 1049409446 8:142465927-142465949 CCTGCTCATGAGACAGGAGCGTG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1049409448 8:142465947-142465969 GTGCGCAGGAGCAGCGTCCTCGG No data
1049409446_1049409454 23 Left 1049409446 8:142465927-142465949 CCTGCTCATGAGACAGGAGCGTG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1049409454 8:142465973-142465995 AGAGCCCTGTGGAGGCCCCGTGG No data
1049409446_1049409453 15 Left 1049409446 8:142465927-142465949 CCTGCTCATGAGACAGGAGCGTG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1049409453 8:142465965-142465987 CTCGGGGTAGAGCCCTGTGGAGG No data
1049409446_1049409450 -1 Left 1049409446 8:142465927-142465949 CCTGCTCATGAGACAGGAGCGTG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1049409450 8:142465949-142465971 GCGCAGGAGCAGCGTCCTCGGGG No data
1049409446_1049409455 24 Left 1049409446 8:142465927-142465949 CCTGCTCATGAGACAGGAGCGTG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1049409455 8:142465974-142465996 GAGCCCTGTGGAGGCCCCGTGGG No data
1049409446_1049409451 12 Left 1049409446 8:142465927-142465949 CCTGCTCATGAGACAGGAGCGTG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1049409451 8:142465962-142465984 GTCCTCGGGGTAGAGCCCTGTGG No data
1049409446_1049409449 -2 Left 1049409446 8:142465927-142465949 CCTGCTCATGAGACAGGAGCGTG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1049409449 8:142465948-142465970 TGCGCAGGAGCAGCGTCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049409446 Original CRISPR CACGCTCCTGTCTCATGAGC AGG (reversed) Intronic
902189724 1:14753936-14753958 CTCACTCCTGTCTCAGGAGAAGG - Intronic
904917244 1:33979112-33979134 CATGCTCCTGTCTCACCTGCTGG + Intronic
906144825 1:43553749-43553771 CAGGCTCCTGTGTCCTGAGTAGG + Intronic
913611341 1:120512545-120512567 CTCTTTCCTGTCTGATGAGCTGG - Intergenic
1064025539 10:11845824-11845846 CACTCTCCTGCCTCAGGAGCAGG - Intronic
1065778492 10:29144508-29144530 CCTTCTACTGTCTCATGAGCTGG + Intergenic
1067557919 10:47285333-47285355 TACCCTCCTGACTCATGATCGGG + Intergenic
1067705409 10:48603569-48603591 CCCACTCCTGTGTAATGAGCTGG - Intronic
1067809574 10:49416938-49416960 AACGCTCCTGTCGTCTGAGCTGG - Intergenic
1069708455 10:70474076-70474098 CACGCTCCTGCCACATGTCCTGG + Intergenic
1073558130 10:104473232-104473254 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1074009865 10:109467250-109467272 CAGGCTCTTGTCTCATGACCAGG - Intergenic
1076717019 10:132371304-132371326 CAAGCTCCTGGCTCATGGGCTGG - Intronic
1078131830 11:8619872-8619894 CACGCTCCTGCCCCATGGCCTGG + Intronic
1080074564 11:28134150-28134172 CATGTTCTTGTCTCATGACCAGG + Intronic
1086405474 11:86495735-86495757 TAACCTCCTGTCTCCTGAGCTGG + Intronic
1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG + Exonic
1091668440 12:2435811-2435833 CTCGCTCCTGCTTCAGGAGCAGG - Intronic
1091877846 12:3951420-3951442 CAAGCTCCTCTCTCATTAACGGG - Intergenic
1106199369 13:27523688-27523710 CACGCTCCAGCCTCATGGGAAGG - Intergenic
1109924043 13:69110298-69110320 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1109998299 13:70159415-70159437 GACACTCTTGTCTCATTAGCAGG + Intergenic
1113076877 13:106475472-106475494 CATGCTCCTGGCTTAGGAGCCGG + Intergenic
1116103520 14:40470522-40470544 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1117656447 14:57961130-57961152 CAGGCTGCTGTCACTTGAGCTGG + Intronic
1117949243 14:61064439-61064461 CATGATCCTATCTCATGAGCAGG - Intronic
1120504885 14:85343013-85343035 CACATGCCTGTCTCTTGAGCAGG + Intergenic
1123036027 14:105472302-105472324 CAGGCTGCTGTCTCATCAGCAGG - Intergenic
1128358229 15:66943298-66943320 CAGGCGCCTGTCTCTAGAGCAGG - Intergenic
1131874478 15:96790157-96790179 CAAGCTCATGTGTCATGGGCAGG + Intergenic
1139532714 16:67550723-67550745 CAGGCTCCTGTGACAAGAGCAGG - Intergenic
1141089667 16:81121555-81121577 CATGCTCATAGCTCATGAGCAGG - Intergenic
1141656836 16:85421199-85421221 CACCCTCCTGTCTCCTGGACGGG + Intergenic
1144334057 17:14253304-14253326 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1145789025 17:27613328-27613350 CAGGTTCTTGTCTCATGACCAGG + Intronic
1152742101 17:82022907-82022929 CGCGCTCCGGTCTCATTGGCTGG - Exonic
1155621173 18:27782115-27782137 CACGATCCTCTCTAGTGAGCTGG + Intergenic
1159580983 18:70234612-70234634 CCTCCTCCTGTCTCATGGGCTGG - Intergenic
1159929715 18:74297994-74298016 CATGTTCCTGTCTCATTAACAGG - Intergenic
1162440603 19:10689913-10689935 CACGCTGCTTTCCCAAGAGCAGG - Exonic
1164810822 19:31154501-31154523 CAGGTTCCTGTCACATGACCAGG + Intergenic
1164826856 19:31290311-31290333 CACCCTCCTGGCTCTTGACCGGG + Intronic
1166196769 19:41211483-41211505 CACTCTCCTGCCTCAGTAGCTGG - Intergenic
1166750031 19:45160178-45160200 CTCCCTCCTGCCTCAGGAGCAGG - Intronic
1167758555 19:51428442-51428464 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1168563024 19:57399085-57399107 CTCGCTTATGTCTCATGAGTCGG - Exonic
924985113 2:263930-263952 CACCCTCCCCTCTCAAGAGCTGG - Intronic
925122944 2:1433074-1433096 CAGTCTCCTGTTTCATTAGCTGG + Intronic
925993905 2:9276277-9276299 CACACTCCTCTCTCCTGAGAAGG - Intronic
928544392 2:32315632-32315654 CACTCTCCTGCCTCAGTAGCTGG - Exonic
931981681 2:67699902-67699924 CTCGCTCCTGGCCCATGAACTGG + Intergenic
948569809 2:238910839-238910861 CACGCTTCTGTATCAAGAGCGGG - Intergenic
1168831459 20:847342-847364 TGAGCTCCAGTCTCATGAGCTGG - Intronic
1170069423 20:12348834-12348856 CATGCCCCTCTCTCATCAGCTGG + Intergenic
1170769435 20:19319199-19319221 GACTCTACTGTCCCATGAGCAGG + Intronic
1170793600 20:19527560-19527582 CTCTCTCCTGCCTCATGAGCAGG - Intronic
1172388206 20:34548477-34548499 CACGCCCCTGGCTCAAGAGGAGG + Intronic
1174801794 20:53570076-53570098 CATGCTCCTGTATCTGGAGCTGG - Intronic
1176412205 21:6455153-6455175 AACGCCCTTGTCTCATCAGCGGG + Intergenic
1177878148 21:26659978-26660000 CAAGTTCTTGTCTCATGACCAGG - Intergenic
1178081429 21:29070363-29070385 CACTGTCCTGTCTAATTAGCGGG - Intronic
1179454636 21:41490742-41490764 CTCCCTCCTGGCCCATGAGCTGG - Intronic
1179687699 21:43063475-43063497 AACGCCCTTGTCTCATCAGCGGG + Intronic
1180207708 21:46272256-46272278 CACTCACCTGTCTCATGAGGAGG + Intronic
1180610717 22:17095977-17095999 CACCCTCCTCTCTCTTGAGAGGG - Intronic
1180663257 22:17487584-17487606 CACTCTCCTGCCTCAGTAGCTGG - Intronic
1182115417 22:27753582-27753604 AAGGCTCCTGTTTCATGGGCAGG - Intronic
1182971962 22:34587573-34587595 CACACTCCTTTCTCACCAGCTGG - Intergenic
1183759104 22:39799432-39799454 CAGGTTCTTGTCTCATGACCAGG + Intronic
1184751741 22:46490219-46490241 TTGGCTCCTGTCTCATGAGATGG - Intronic
950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG + Exonic
954758082 3:52853380-52853402 CATGCTCCTGTCACATGGGTCGG - Intronic
955733372 3:62010908-62010930 CAGGTTCTTGTCTCATGACCAGG + Intronic
960969800 3:123131256-123131278 CAAGACCCTGTCTCATTAGCCGG + Intronic
962881243 3:139578838-139578860 CACTCTCCTGTGTGATGACCAGG - Intronic
964762257 3:160145708-160145730 CAAGCTCCAATCTCATGACCTGG + Intergenic
965973724 3:174595162-174595184 CACATTCAGGTCTCATGAGCTGG + Intronic
968674587 4:1870924-1870946 CAAGCTCCTGTCCCGTGAGAGGG - Intergenic
970207123 4:13666182-13666204 CAGGCTCATGACTCATGAGAGGG - Intergenic
973238596 4:47932710-47932732 CAAGTTCTTGTCTCATGACCAGG + Intronic
976461858 4:85320935-85320957 CAAGTTCTTGTCTCATGACCAGG + Intergenic
976751538 4:88455263-88455285 CAGGTTCTTGTCTCATGACCAGG + Intergenic
977823461 4:101502803-101502825 CAGGCTCTTGTCACATGACCAGG - Intronic
985395443 4:189538718-189538740 GACGGTCCTGTCTCATGGGCAGG - Intergenic
989153033 5:38319026-38319048 CATGCTCCAGGCTCATGAGATGG + Intronic
1000305099 5:159987481-159987503 CACGCCCCTTTCCCCTGAGCAGG + Intergenic
1001022932 5:168198907-168198929 TGCGCTCCTGGCTCATGAACGGG - Exonic
1001184079 5:169550643-169550665 AACCCCCTTGTCTCATGAGCAGG + Intergenic
1002461711 5:179377109-179377131 CTCACTCCTGTCTCAGGACCAGG + Intergenic
1007026879 6:38585124-38585146 CATGCTCTTGTCTCCTGAGATGG - Intronic
1019434564 7:1015377-1015399 CAAGTCCCTGTCTCATGAACAGG + Intronic
1020596607 7:10214171-10214193 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1020956530 7:14745819-14745841 CAGGTTCTTGTCTCATGACCAGG - Intronic
1021874486 7:25035965-25035987 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1026123028 7:67554160-67554182 CAAGCTCCTGTATCATGCTCTGG + Intergenic
1029002453 7:97168187-97168209 CAAGTTCTTGTCTCATGACCAGG - Intronic
1030496621 7:110308801-110308823 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1031616481 7:123887883-123887905 CAGGCTCTTGACTCATGACCAGG - Intergenic
1034865269 7:154636350-154636372 CTGGCTCCTGTGTCCTGAGCAGG - Intronic
1034887453 7:154808801-154808823 CACAATCCTGTCTCAGAAGCAGG + Intronic
1035922407 8:3691983-3692005 CAGCATCCTGTCTCATGAGCTGG - Intronic
1037912671 8:22753267-22753289 CTCCCTCCTGACTCCTGAGCAGG - Intronic
1039701079 8:39962552-39962574 CAGGATCTTGTCTCATGACCAGG + Intronic
1040662959 8:49596747-49596769 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1042811522 8:72830672-72830694 CATGCTTCTGGCTCATCAGCAGG + Intronic
1048419135 8:134260054-134260076 CACCCAACAGTCTCATGAGCTGG - Intergenic
1049091768 8:140520062-140520084 CACGCTTCTGCCTCGGGAGCTGG + Intergenic
1049382619 8:142325028-142325050 CACGGCCCAGTTTCATGAGCAGG + Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1051536057 9:18159309-18159331 CAAGCTCATGTCTCATGGGTAGG - Intergenic
1060486916 9:124053629-124053651 CAGGGTCTTGTCTCATGACCAGG - Intergenic
1188179288 X:27034365-27034387 CGGGTTCCTGTCTCATGACCAGG + Intergenic
1191006533 X:55716198-55716220 CCCGCTCCTGTATCATAAGCTGG + Intergenic
1193224129 X:78961498-78961520 CACTCTCCTTGCTCATGAGGCGG - Exonic
1200037940 X:153345498-153345520 CAATCTCCTTTCCCATGAGCAGG + Exonic