ID: 1049409449

View in Genome Browser
Species Human (GRCh38)
Location 8:142465948-142465970
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049409444_1049409449 18 Left 1049409444 8:142465907-142465929 CCTCTGGGACACTGGCTTTTCCT 0: 1
1: 0
2: 2
3: 37
4: 319
Right 1049409449 8:142465948-142465970 TGCGCAGGAGCAGCGTCCTCGGG No data
1049409446_1049409449 -2 Left 1049409446 8:142465927-142465949 CCTGCTCATGAGACAGGAGCGTG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1049409449 8:142465948-142465970 TGCGCAGGAGCAGCGTCCTCGGG No data
1049409443_1049409449 22 Left 1049409443 8:142465903-142465925 CCAGCCTCTGGGACACTGGCTTT 0: 1
1: 0
2: 5
3: 29
4: 278
Right 1049409449 8:142465948-142465970 TGCGCAGGAGCAGCGTCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr