ID: 1049409454

View in Genome Browser
Species Human (GRCh38)
Location 8:142465973-142465995
Sequence AGAGCCCTGTGGAGGCCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049409446_1049409454 23 Left 1049409446 8:142465927-142465949 CCTGCTCATGAGACAGGAGCGTG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1049409454 8:142465973-142465995 AGAGCCCTGTGGAGGCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049409454 Original CRISPR AGAGCCCTGTGGAGGCCCCG TGG Intronic
No off target data available for this crispr