ID: 1049409454 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:142465973-142465995 |
Sequence | AGAGCCCTGTGGAGGCCCCG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1049409446_1049409454 | 23 | Left | 1049409446 | 8:142465927-142465949 | CCTGCTCATGAGACAGGAGCGTG | 0: 1 1: 0 2: 0 3: 11 4: 104 |
||
Right | 1049409454 | 8:142465973-142465995 | AGAGCCCTGTGGAGGCCCCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1049409454 | Original CRISPR | AGAGCCCTGTGGAGGCCCCG TGG | Intronic | ||
No off target data available for this crispr |