ID: 1049411294

View in Genome Browser
Species Human (GRCh38)
Location 8:142475138-142475160
Sequence GATGGTAAGCAGAGGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 332}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049411294_1049411300 -4 Left 1049411294 8:142475138-142475160 CCCTCTACCCTCTGCTTACCATC 0: 1
1: 0
2: 2
3: 39
4: 332
Right 1049411300 8:142475157-142475179 CATCAGGACGCTGTGCTCTGAGG No data
1049411294_1049411301 7 Left 1049411294 8:142475138-142475160 CCCTCTACCCTCTGCTTACCATC 0: 1
1: 0
2: 2
3: 39
4: 332
Right 1049411301 8:142475168-142475190 TGTGCTCTGAGGCAGCCCTCTGG No data
1049411294_1049411303 11 Left 1049411294 8:142475138-142475160 CCCTCTACCCTCTGCTTACCATC 0: 1
1: 0
2: 2
3: 39
4: 332
Right 1049411303 8:142475172-142475194 CTCTGAGGCAGCCCTCTGGTGGG No data
1049411294_1049411304 14 Left 1049411294 8:142475138-142475160 CCCTCTACCCTCTGCTTACCATC 0: 1
1: 0
2: 2
3: 39
4: 332
Right 1049411304 8:142475175-142475197 TGAGGCAGCCCTCTGGTGGGCGG No data
1049411294_1049411302 10 Left 1049411294 8:142475138-142475160 CCCTCTACCCTCTGCTTACCATC 0: 1
1: 0
2: 2
3: 39
4: 332
Right 1049411302 8:142475171-142475193 GCTCTGAGGCAGCCCTCTGGTGG No data
1049411294_1049411305 17 Left 1049411294 8:142475138-142475160 CCCTCTACCCTCTGCTTACCATC 0: 1
1: 0
2: 2
3: 39
4: 332
Right 1049411305 8:142475178-142475200 GGCAGCCCTCTGGTGGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049411294 Original CRISPR GATGGTAAGCAGAGGGTAGA GGG (reversed) Intronic
900603172 1:3511855-3511877 CTTGGTGAGCAGAGGGTCGAGGG - Intronic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
904716970 1:32475742-32475764 GAAGGTAAGAAGAGGGGACAGGG + Intronic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
906316169 1:44787562-44787584 GATGCTAAGCACAGCGTACAAGG + Exonic
906567947 1:46813890-46813912 CCTGCTAAGCAGAGGGTAGGAGG - Exonic
906747245 1:48230702-48230724 GCAGGTAGGCAGAGGGAAGAGGG + Exonic
906826733 1:48989532-48989554 GATGGTTACCAGAGGCTGGAAGG - Intronic
907000061 1:50843546-50843568 GGTGGTAACCAGAGGCTGGAAGG - Intronic
907195558 1:52683817-52683839 CATAGTAACCAAAGGGTAGAAGG - Intergenic
909435164 1:75632534-75632556 AATGGTCAGCAGAGGGTGAAGGG - Intergenic
910405951 1:86890464-86890486 GTTATTAAGTAGAGGGTAGAAGG - Intronic
911437287 1:97877255-97877277 GATGGTGACCAGTGGGAAGATGG + Intronic
911812680 1:102303369-102303391 GATGGTAAGTTGTGGGAAGAGGG - Intergenic
912860416 1:113209208-113209230 GATGGCATGCAGAAGGAAGAGGG + Intergenic
914216264 1:145632411-145632433 GATGGTTACCAGAGGCTGGATGG - Intronic
914468835 1:147955070-147955092 GATGGTTACCAGAGGCTGGATGG - Intronic
915653195 1:157334746-157334768 GATGCTGAGCAGAGGGTAGGGGG - Intergenic
915684369 1:157616754-157616776 GATGCTGAGCAGAGGGTAGGGGG + Intergenic
916830123 1:168482275-168482297 CATGGCAGGCTGAGGGTAGATGG + Intergenic
917297861 1:173540487-173540509 GGTGGTGGGCAGAGGGTAGGGGG + Intronic
918105973 1:181415511-181415533 GAGGGTAACCAGAGGGTATAGGG + Intronic
918407174 1:184222745-184222767 GATGGCCAGCAGAGGGCAGATGG - Intergenic
918952748 1:191160690-191160712 GAAGGGAAGGAGAGGGGAGAGGG + Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
920205590 1:204288611-204288633 GATGGGAAGCAGTGGGAAGGTGG + Intronic
922789255 1:228301418-228301440 CATTATAACCAGAGGGTAGAGGG - Intronic
924250263 1:242125885-242125907 CATGGTAACCACAGGATAGATGG + Intronic
1062922882 10:1293155-1293177 GAGGGTAAGAAGGGGGGAGAGGG + Intronic
1063040923 10:2336478-2336500 GGTGGTAAGCAGATGATGGATGG + Intergenic
1063136668 10:3223064-3223086 GGTGGTTGGCATAGGGTAGAGGG - Intergenic
1063295032 10:4796769-4796791 GACAGTAGGCAGATGGTAGAGGG - Intronic
1063311614 10:4957822-4957844 GATGGAAAGCAGATGGAAGATGG - Intronic
1066658943 10:37721010-37721032 GGTGGGAAGCAGAGGCTGGATGG - Intergenic
1067288701 10:44926265-44926287 GCTGGAAAGCAGTGGGTAGCAGG + Intronic
1067304708 10:45050943-45050965 GAGGGTAGGCAGAGGGTATATGG + Intergenic
1068196626 10:53725999-53726021 AATGGGAGGCAGAGAGTAGAGGG + Intergenic
1068656155 10:59578094-59578116 AGTAGTAAGCAGATGGTAGAGGG + Intergenic
1069001684 10:63273812-63273834 GAAGGTAAACAGAGGCTAAAAGG + Intronic
1071146117 10:82574376-82574398 GCTGGGAAGCATAGGGCAGAAGG + Intronic
1071204147 10:83254742-83254764 GATGGAAGGCAAAGGGTAGCAGG + Intergenic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072818383 10:98531802-98531824 GTTGGTAAGCAAACAGTAGAGGG - Intronic
1074736632 10:116441251-116441273 GATGGAAAACAGATGGCAGATGG + Intronic
1075609592 10:123841762-123841784 GATGGTAATCACAGGAGAGATGG - Intronic
1076436397 10:130447074-130447096 GATGGAAAGAAGAGGGAAAAAGG - Intergenic
1076594485 10:131617444-131617466 GAAGGTGGGCAGAGGGCAGAAGG + Intergenic
1077159513 11:1106311-1106333 GATGGTAGACAGATGGTGGATGG - Intergenic
1077159524 11:1106357-1106379 GATGGTAGACAGATGGTGGATGG - Intergenic
1077371907 11:2186240-2186262 GGTGGCAAGCAGAGGTCAGATGG - Intergenic
1077966878 11:7144076-7144098 GATGCTAAGAAGACTGTAGAGGG + Intergenic
1078175859 11:8969853-8969875 GATGGTTATCAGAGAGTAGGGGG - Intergenic
1078630385 11:12998026-12998048 GATGGTAATCAGGGGCTGGAGGG - Intergenic
1078706427 11:13748228-13748250 GTTGATAAGCAGAGAGGAGAAGG - Intergenic
1078758848 11:14235569-14235591 TTTGGTATGCTGAGGGTAGAAGG + Intronic
1078919677 11:15817861-15817883 GATGGGAAGAAGATGGAAGAGGG - Intergenic
1079002598 11:16770363-16770385 AATGGAAGGCAGAGGGTGGAGGG + Intergenic
1079968594 11:27008196-27008218 CATGGAAAGGAAAGGGTAGAGGG + Intergenic
1080220125 11:29893289-29893311 GATGGTAACCAGAGGCTGGAGGG + Intergenic
1081096184 11:38938983-38939005 GATGGTAAAATGAGGGCAGATGG - Intergenic
1081160397 11:39741914-39741936 GATGGTTATCAGAGGCTGGAAGG + Intergenic
1083482601 11:62959421-62959443 GATGGTAAGATGAGGGCACAGGG + Intronic
1083735540 11:64678232-64678254 GATGGGGAGGAGAGGGAAGAGGG - Intronic
1085473178 11:76771220-76771242 GACAGAAAGCAGAGGGTGGAAGG - Intergenic
1085515470 11:77109308-77109330 GATGGTAACCAAATAGTAGATGG - Intronic
1085820377 11:79786689-79786711 GATGGGCGGCAGAGGGTGGAGGG + Intergenic
1088166649 11:106946086-106946108 GATGGTGAGGAGAGGGGAGAAGG + Intronic
1091441061 12:512027-512049 GGTGGAAGGCAGAAGGTAGAAGG - Intronic
1091441177 12:512496-512518 GGTGGAAGGCAGAAGGTAGAAGG - Intronic
1091571635 12:1691496-1691518 GAAGGTGAGCAGAGGGCAGCAGG - Intronic
1092542143 12:9426657-9426679 CATGGGAAGAAGAGGGGAGAAGG + Intergenic
1092859286 12:12706037-12706059 TAGTCTAAGCAGAGGGTAGATGG - Intergenic
1092957812 12:13565736-13565758 GATGGGAATGAGAGGGGAGAGGG + Intronic
1094510869 12:31095776-31095798 CATGGGAAGAAGAGGGGAGAAGG - Intronic
1095378156 12:41556719-41556741 GATAGTAAGCAGACTGTAGGAGG + Intronic
1095688428 12:45061589-45061611 GATAGCAAGCAGAGGCTTGAAGG + Intergenic
1097226383 12:57478976-57478998 GATGGTTAGCAGAAGCTTGAGGG + Intronic
1097961474 12:65535704-65535726 GAAGGTAAGCACAGGGAACACGG + Intergenic
1098100205 12:67007141-67007163 GGTGATGGGCAGAGGGTAGAGGG + Intergenic
1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG + Intergenic
1099027123 12:77478787-77478809 GATGGTTACCAGAGGCTAGAAGG - Intergenic
1100002277 12:89851527-89851549 GAAGGTAGGCAGAAGGGAGAAGG - Intergenic
1101125944 12:101633767-101633789 GATGTCAAGCAGAGGCTGGATGG + Intronic
1101212581 12:102549313-102549335 TTTGGTAATCAGGGGGTAGAAGG + Intergenic
1101227608 12:102705465-102705487 GATGGAAAGCAGATGGTAGAGGG - Intergenic
1101248721 12:102910762-102910784 GAAGGTAAGGAGAGGGCAAATGG - Intronic
1102796850 12:115696336-115696358 TATGGTAAGCAGAGGCTGCAGGG + Intergenic
1102865218 12:116368887-116368909 GAGGGGAAGCAGAATGTAGACGG + Intergenic
1104225853 12:126832245-126832267 GATGGTAATGACAGAGTAGAAGG - Intergenic
1105033083 12:132898383-132898405 GAGGGTCAGCAAAGGGGAGATGG - Intronic
1105510544 13:21048500-21048522 TATGGTAGGTAGAGGGTGGATGG - Intronic
1106174737 13:27320573-27320595 GCTGGTAAGCAGAGGGAAAAGGG + Intergenic
1111092981 13:83471910-83471932 TAGAGTAAGCAGAGGGCAGAAGG - Intergenic
1111867048 13:93782095-93782117 GGTGGTTATCAGAGGCTAGAGGG - Intronic
1112802195 13:103124745-103124767 GGTGGGAGGCAGTGGGTAGAAGG + Intergenic
1113409548 13:110072733-110072755 GATGGTGGGCAGAGGATGGAAGG + Intergenic
1115708550 14:36024732-36024754 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1116940348 14:50784945-50784967 GAGAGTAGGCAGAGGGGAGAAGG + Intronic
1118540631 14:66820163-66820185 GAAGGTAAGGAGAGGGTAGGTGG - Intronic
1119423963 14:74524137-74524159 GATGGGAAGCAGGGGGCAGGGGG - Intronic
1119768693 14:77206630-77206652 GATGGGGAGGAGAGGGTGGAGGG - Intronic
1119901481 14:78264255-78264277 GTTGGGAAGCAGAAGCTAGAAGG - Intronic
1120075964 14:80158729-80158751 GATAGAAATGAGAGGGTAGAGGG - Intergenic
1120161596 14:81151419-81151441 GATGGTTACCAGAGGCTAGGGGG - Intergenic
1120213542 14:81658171-81658193 CTTGGAAAGTAGAGGGTAGAGGG + Intergenic
1120527000 14:85588777-85588799 GATGGTTACCAGAGGCTGGAAGG - Intronic
1120857228 14:89223206-89223228 GATGGGAGGCCGAGGGTGGAAGG + Intronic
1121382233 14:93482788-93482810 GATGGAGAGCAGAAGGTAGGAGG - Intronic
1121911947 14:97799740-97799762 GATGGTTACCAGAGGCTGGAGGG + Intergenic
1122504909 14:102226324-102226346 GGTGCTCAGCAGAGGGTTGAGGG + Intronic
1122654682 14:103250031-103250053 GATGGTAACCAGAGCATGGAAGG + Intergenic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1124608756 15:31193266-31193288 GAGGGAAAGCAGATGGAAGAGGG - Intergenic
1124849364 15:33321429-33321451 CATGGAAAGCAGAGGGAAAAAGG - Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125953519 15:43774120-43774142 GATGGTTAGCAGGGGGTTAATGG + Intronic
1126244117 15:46483799-46483821 TATGGTGTGCAGAGGGAAGATGG + Intergenic
1126503587 15:49377038-49377060 GATGGTTACCAGAGGCTGGAAGG - Intronic
1128129204 15:65214570-65214592 TATGGTAAGTACAGGGTTGAGGG + Intergenic
1128234807 15:66060073-66060095 GATGGACAGCAGAGGGATGAAGG + Intronic
1128250803 15:66163137-66163159 GTTGGGAAACAGAGGGCAGAGGG + Intronic
1129022146 15:72530063-72530085 AATTGATAGCAGAGGGTAGATGG + Intronic
1130794336 15:87193036-87193058 GGTGGAAAGCAGAGAGAAGAAGG + Intergenic
1130994887 15:88898140-88898162 GGTAGAAAGCAGAGGGAAGAGGG + Intergenic
1131525820 15:93151658-93151680 GGTGGTTAGCAGAGGCTGGAAGG - Intergenic
1133448050 16:5879276-5879298 GATGGTAAGCAGAAGCTGGAGGG + Intergenic
1133692786 16:8232724-8232746 GGTGGGTGGCAGAGGGTAGAGGG - Intergenic
1134112519 16:11524191-11524213 GATGGATAGGAGAGGGTAGTGGG - Intergenic
1134795848 16:17036107-17036129 GATGGGAAAGAGTGGGTAGAGGG + Intergenic
1138024454 16:53511742-53511764 GAAGATAAGCAGAGGCTAAACGG - Intergenic
1138389669 16:56661303-56661325 GATGGTGCGCAGAGGGAGGAAGG - Intronic
1139130056 16:64132237-64132259 GATGGTAAGAAGAAGATAAAAGG - Intergenic
1140204476 16:72922303-72922325 GATGGTTAGGAGAGGATGGAGGG - Intronic
1140556824 16:75930903-75930925 AATATTAAGCAGAGAGTAGAAGG - Intergenic
1141955292 16:87366749-87366771 GAGGGGAGGCAGAGGGCAGACGG + Intronic
1142584485 17:962862-962884 GATGGAAAGCAGTGAGAAGATGG - Intronic
1142698618 17:1646691-1646713 GATGGTGAGAAAAGGGGAGAGGG + Intronic
1145770833 17:27491899-27491921 GATGGTGAGCAGAGTATAGCAGG - Intronic
1146303826 17:31714370-31714392 GATGGTTACCAGAGGCTAAATGG + Intergenic
1147158544 17:38557895-38557917 GAAAGTAGGCAGAGGGCAGAGGG + Intronic
1148019220 17:44542415-44542437 GGTTGGAAGCAGAGGGAAGATGG - Intergenic
1148157355 17:45431752-45431774 GCTGGCAAGCAGAGCGAAGAGGG + Intronic
1148682149 17:49480458-49480480 GCTGGGAAGCAGAGGGGAGAAGG + Intergenic
1150200394 17:63350296-63350318 GGGGGAAAGCAGAGGGAAGAGGG - Intronic
1150447520 17:65238715-65238737 GATGGAATGATGAGGGTAGATGG - Intergenic
1150457176 17:65315732-65315754 TATGGTATCCAGAGTGTAGAAGG - Intergenic
1150514041 17:65788963-65788985 TATGGTAAGGAAAGGGCAGATGG - Intronic
1153264964 18:3261499-3261521 GAGGGTAAGCAGAGAGGAGTAGG + Intergenic
1156133018 18:34001579-34001601 GATGGCAAGGGCAGGGTAGAGGG + Intronic
1156837625 18:41574412-41574434 GATGGAAAAAAGAGGGTGGAGGG + Intergenic
1157065556 18:44345496-44345518 GATGGTCAGCAGAGGCTAGGAGG - Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157752774 18:50194155-50194177 GAGGGTAAGCAATGGGTAGAGGG - Intronic
1158564017 18:58538939-58538961 GATGGGAGGCAGAGGGGAGCTGG - Intronic
1158934127 18:62349041-62349063 GATGGAAGGCAGAGGGGAGAGGG + Intronic
1159622279 18:70651958-70651980 GATGGTAAGGAGAGGCAAGCTGG + Intergenic
1161026427 19:2039350-2039372 GAAGGTGAGCAGAGGGTAGGTGG - Exonic
1163350974 19:16776993-16777015 GAGGGAAAGGAGAGGGAAGAGGG + Intronic
1164398417 19:27886361-27886383 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1164456766 19:28414164-28414186 GATGGTGAGCAGGTGGTATAAGG - Intergenic
1164597881 19:29542013-29542035 GATGGTGAGTAGATGGTAGATGG + Intronic
1164597891 19:29542071-29542093 GATGATGAGTAGATGGTAGATGG + Intronic
1165149916 19:33754109-33754131 GATGGTACACAGAGGGTAGTGGG - Intronic
1165693469 19:37882740-37882762 GAGGGGAAGCAGAGGATAGAGGG - Intergenic
1166203647 19:41254576-41254598 GAGGGTAAGGGGAGGGTAGAAGG + Intronic
1167284510 19:48591577-48591599 GATGGTGAGGAGAGGGGAGAAGG - Intronic
1167538775 19:50072315-50072337 GATGGTAAGGAGGGTGTAGGAGG + Intergenic
1167767506 19:51493440-51493462 TATAGTCAGCAGAGGGGAGAGGG - Intronic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926693919 2:15757393-15757415 GATGGTATGCAGAGAAAAGAAGG + Intergenic
927594562 2:24385306-24385328 GATGGTTACCAGAGGCTGGAGGG - Intergenic
930975001 2:57446791-57446813 GAGGGAAAGCAGAGGAAAGAGGG + Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931642897 2:64396955-64396977 GATGGTGAGGAGAGGATTGAGGG - Intergenic
932464060 2:71902096-71902118 GGTGGAAATCAGAGGGTAGCAGG - Intergenic
933970635 2:87467171-87467193 TCTGGCAAGCAGAGGGCAGATGG - Intergenic
934115066 2:88781049-88781071 AATGGAAAGCAGAAGTTAGAAGG + Intergenic
935654760 2:105412635-105412657 GATGGTTAGGAGTGGGTCGAAGG + Intronic
936323094 2:111483011-111483033 TCTGGCAAGCAGAGGGCAGATGG + Intergenic
936549071 2:113419342-113419364 GATGGTTACCAGAGGCTGGAAGG + Intergenic
936580371 2:113695108-113695130 GATGGTTACCAGAGGCTGGAGGG + Intergenic
936924616 2:117723586-117723608 GAAGGTAAGCAGTGGAGAGAAGG + Intergenic
937006277 2:118519657-118519679 CATGGTAAGCAGAGCCAAGAGGG - Intergenic
937097029 2:119242163-119242185 GATGGCAGGCAGCGGGGAGAGGG + Intronic
937123222 2:119455173-119455195 GGAGGTGGGCAGAGGGTAGAGGG - Intronic
937570251 2:123349150-123349172 GATGGTAGCTAAAGGGTAGAGGG + Intergenic
938212918 2:129483623-129483645 GATGCTCAGCAGAGTTTAGATGG - Intergenic
938410211 2:131057465-131057487 GACGGAAATCAGAGGGGAGAGGG + Intronic
938821055 2:134960573-134960595 GCTGGTAAGGAGAGGGAAGCTGG - Intergenic
941035635 2:160566016-160566038 GATGGTTATCAGAGGCTAGGGGG + Intergenic
942724462 2:178991515-178991537 GATGGTTACCAGAGGCTAGGAGG + Intronic
942769633 2:179501562-179501584 GATGGTTACCAGAGGCTGGAAGG + Intronic
943748046 2:191482842-191482864 GATGGGGAGCTGAGGGGAGAGGG + Intergenic
943831934 2:192474135-192474157 GATGGTAGGGAGAGAGTATAAGG + Intergenic
943990203 2:194679539-194679561 GATAGAAAGGAGATGGTAGATGG + Intergenic
946167604 2:217874600-217874622 GATGGTTCCCAGAGAGTAGAGGG + Intronic
946231150 2:218292045-218292067 GCTGGTGAGAAGAGGGAAGAGGG - Intronic
946332795 2:219019649-219019671 GATGGAAAGCAAGGGGTACACGG + Exonic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947360766 2:229343202-229343224 GATGGTAGGAAGTGGGAAGACGG - Intergenic
947460155 2:230297160-230297182 GATGATAATTAGAGGTTAGATGG + Intronic
948476965 2:238226615-238226637 GATGGTAAGAAGGGGAGAGAGGG + Intronic
948909620 2:240996520-240996542 GAAGGTCAGCAGTGGGGAGAAGG + Intergenic
1170810891 20:19673484-19673506 GATAGTAAGGAGAAGGCAGACGG - Intronic
1171501470 20:25596877-25596899 GTTGGTAGACAGATGGTAGATGG - Intergenic
1172827465 20:37802346-37802368 GATGGGATGAAGAGGGTAGGGGG + Intronic
1172853522 20:37983649-37983671 GATGGAAAGGAGTGAGTAGAGGG + Intronic
1172895235 20:38295553-38295575 GATGTGAAGCAGAGGGGGGATGG + Intronic
1174313387 20:49677326-49677348 GATGGTGTGCAGAGGGTGGTTGG - Intronic
1174507635 20:51026946-51026968 GATGGTATGATGTGGGTAGAGGG - Intergenic
1174597182 20:51693378-51693400 GCTGGTAGGCAGAGGAGAGAGGG + Intronic
1174851183 20:53996761-53996783 GGTGGTAAGGAGTGGGAAGATGG - Intronic
1174951829 20:55050793-55050815 GATGGGAAGGAGAGGGAAGCGGG + Intergenic
1175638279 20:60603648-60603670 GATGGTAAGAGGAGGGTGCAGGG - Intergenic
1175701759 20:61143360-61143382 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1176943355 21:14950698-14950720 GATGCTATGGAGAGGGAAGAGGG - Intergenic
1177996875 21:28111282-28111304 GCTGGTAAGCAAAGAGAAGACGG - Intergenic
1178117383 21:29431414-29431436 CATGGAAAGGAGGGGGTAGAGGG - Intronic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179601323 21:42479404-42479426 GATGATGAGAAGAAGGTAGAAGG - Intronic
1181137119 22:20775865-20775887 GAAAGTAAGCAGCTGGTAGAAGG - Intronic
1181164475 22:20976024-20976046 GAGGGTAAGGAGAGGTTTGAGGG + Intronic
1181633547 22:24163871-24163893 GATGGCAAGAAGTGGGAAGAGGG + Intronic
1183814665 22:40289677-40289699 GATGGTGAGGAGAGGTTCGAAGG - Intronic
1185120268 22:48962153-48962175 GATGGTAAGAAGAGGCAAGCTGG + Intergenic
949289791 3:2450865-2450887 TATGGTAAGCAGAGAGGACAGGG - Intronic
949817691 3:8077710-8077732 GAGGGAAAGTAAAGGGTAGATGG - Intergenic
950806969 3:15613513-15613535 GAAGGTAAGGAGGGGGAAGAGGG - Intronic
951132361 3:19062816-19062838 GATGGGAAACAAAGGCTAGAGGG - Intergenic
952489256 3:33850866-33850888 GAGGGAAAGAAGAGGGTACAGGG - Intronic
952992260 3:38842016-38842038 GATGTTAAACAGAAGGTACAGGG - Intergenic
953731767 3:45455974-45455996 GATGGTTACCAGAGGCTGGAGGG + Intronic
954361828 3:50126244-50126266 GATGGTGGGAAGAGGGGAGAGGG + Intergenic
954873864 3:53787805-53787827 GATGCTAAGGACAGGGAAGAGGG + Intronic
956374683 3:68601775-68601797 GGTGGTCATCAGAGGCTAGAAGG - Intergenic
957260274 3:77893092-77893114 GATGGGAAACAGCGGGTCGATGG - Intergenic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
962203077 3:133415850-133415872 GAGGGTGAGTAGAGGGGAGAGGG - Intronic
962256404 3:133872884-133872906 GATGGAAAGGGGAGGGTAGAGGG + Intronic
963281348 3:143387372-143387394 AAAGGTAAGCCGAGGGTGGAGGG + Intronic
963772053 3:149396928-149396950 GATGTTGAGTCGAGGGTAGAAGG + Intergenic
963922286 3:150917294-150917316 GATGTTAAGCAGAGGTGTGAGGG - Intronic
964525216 3:157610027-157610049 GACACAAAGCAGAGGGTAGAAGG + Intronic
965369818 3:167847998-167848020 GAGGGTTAGGAGAGGGGAGATGG - Intergenic
966275932 3:178168945-178168967 GATGGTTACCAGAGGCTAGAAGG + Intergenic
966678870 3:182619194-182619216 GATGGTTTGGAGATGGTAGAGGG - Intergenic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
970318634 4:14854061-14854083 GATGATAGGCAGAGATTAGAAGG - Intergenic
971580826 4:28337437-28337459 GAAGGCAAACAGAAGGTAGAAGG + Intergenic
974469711 4:62302690-62302712 GCTGGAAAGGGGAGGGTAGATGG + Intergenic
975831442 4:78373230-78373252 TATGGTATACAGAGGGTTGAAGG - Intronic
977917972 4:102614560-102614582 GAGGCCAAGCAGAGGGTGGAAGG - Intronic
979732139 4:124037146-124037168 GATGGTAAGGTTAAGGTAGATGG - Intergenic
981142339 4:141283032-141283054 GAAGGTAAGCAGATGGTGAATGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
982479101 4:155887270-155887292 TGTGATAAGTAGAGGGTAGAGGG - Intronic
982583822 4:157211956-157211978 GATGGTTCGCAGAGGCTGGATGG - Intronic
984825069 4:183916855-183916877 GATAGGAAGTAGAGGGAAGAGGG - Intronic
985058352 4:186055474-186055496 GCTAGGAAGCAGAGGGTAGCAGG - Intergenic
988602547 5:32653428-32653450 GTTGGTAAGCAGAGGGCAGAGGG + Intergenic
989058985 5:37391422-37391444 GGTGGTTATCAGAGGCTAGAGGG - Intronic
989199199 5:38746768-38746790 GATGGTCAGCAAAGGGAAGAAGG + Intergenic
990353455 5:54941468-54941490 GAAGGGAAACAGAGGGTAGCAGG - Intergenic
990784420 5:59403465-59403487 GATGGTTACCAGAGGCTAGGAGG - Intronic
991214322 5:64144759-64144781 GCTGGTGATCAGAGGGTGGAAGG - Intergenic
991676835 5:69096593-69096615 AATGGTAAGCAGAGTTAAGAGGG - Intronic
995243177 5:109908355-109908377 GATAGGCAGCAGAGGGAAGATGG - Intergenic
996557709 5:124796301-124796323 GATGGGAAGGTGAGGGTGGAGGG - Intergenic
996816591 5:127580888-127580910 GATGGTTACCAGAGGTGAGAGGG + Intergenic
997178393 5:131802397-131802419 GATGGGGAGCAGAGAGGAGATGG + Intergenic
997749544 5:136330968-136330990 GTGGGTAAGCAGAGGGTTTATGG + Intronic
997835329 5:137187444-137187466 AGTGGTAACTAGAGGGTAGAAGG - Intronic
998151772 5:139761646-139761668 CATGGAAAGCAGAGGTTAGGGGG - Intergenic
999321310 5:150616824-150616846 GGTGGTGAGGAGGGGGTAGATGG - Intronic
1000101996 5:158025173-158025195 GATGGGAATCAGAGGATAGTTGG - Intergenic
1000250537 5:159490588-159490610 GATTATAAGCAGAGGCTAGGAGG - Intergenic
1000585555 5:163093677-163093699 TATGGGATGCATAGGGTAGAGGG - Intergenic
1001972443 5:175967658-175967680 GAAGGTGAGGAGAGGGTGGATGG - Intronic
1002244996 5:177876122-177876144 GAAGGTGAGGAGAGGGTGGATGG + Intergenic
1003889150 6:10548517-10548539 GATGGTAATAAGAGGGTACCAGG - Intronic
1010653888 6:78488723-78488745 GAAGGTAAGGAGAGGGGAGAGGG + Intergenic
1011061439 6:83274295-83274317 GAAGTTAAGCAGTGGATAGATGG + Intronic
1011703362 6:89976331-89976353 GATGGTAATAATAGGATAGAAGG - Intronic
1012309659 6:97706573-97706595 AATTGTAAGCAGAGTGCAGAAGG - Intergenic
1012823533 6:104120212-104120234 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1012973013 6:105751727-105751749 GATGGTTACCAGAGGATAGTGGG - Intergenic
1013478086 6:110528130-110528152 GATGGTTTGCAGAAGGTAGTTGG - Intergenic
1014733904 6:125068863-125068885 GAAGGTAATCATTGGGTAGAGGG + Intronic
1015235371 6:130964825-130964847 GAAGGTAAAAAGAGGATAGATGG + Intronic
1015437019 6:133201345-133201367 ATTGGTAAGCTGAGGGTAGAAGG - Intergenic
1016271834 6:142299440-142299462 GGTGGTTACCAGAGGCTAGAGGG + Intergenic
1016739649 6:147513731-147513753 AAGGGTAAGCAGAGGGTAGGTGG + Intronic
1018839467 6:167507953-167507975 GATGGGAAGGAGAGGGGACAGGG - Intergenic
1018839691 6:167508518-167508540 GATGGGAAGGAGAGGGGACAGGG - Intergenic
1019064672 6:169287216-169287238 GAGGGACAGCAGAGGGGAGAGGG + Intergenic
1019830286 7:3321714-3321736 GATGGGAGGGAGAGGGGAGAGGG - Intronic
1028394715 7:90355748-90355770 GATCCTAAGCAGAGGCAAGAAGG - Intronic
1029930696 7:104367550-104367572 GATGTTAAGCAGATGGAACAGGG + Intronic
1030555545 7:111019850-111019872 TATGGAAAGCAGAGGGAAGGAGG - Intronic
1031272050 7:119663896-119663918 GAGGGGAAGTAGAGGGTTGAGGG + Intergenic
1031859519 7:126961986-126962008 GAAGGTTAGGAGAGGGGAGAAGG - Intronic
1032119038 7:129143249-129143271 GATGGTTAGGAGAGGATAGAAGG - Intergenic
1032658993 7:133962519-133962541 GAAGGGAACCAGAGGGTCGAAGG - Intronic
1033877054 7:145834437-145834459 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1034348532 7:150401939-150401961 GGTGGTGAGCAGAGGGGAGAAGG - Intronic
1038053687 8:23837677-23837699 GAGGGGAAGCAGAGGGGAGCAGG + Intergenic
1038193221 8:25343072-25343094 CCTGGGAAGCAGAGGTTAGAGGG - Intronic
1038307971 8:26421711-26421733 GATGATAAGCAGAGGGAATATGG + Intronic
1039688019 8:39828286-39828308 AATGGGAAGCAGAGGGTAAAGGG + Intronic
1039953033 8:42187148-42187170 GATGATAAATAGACGGTAGATGG - Intronic
1041976696 8:63807278-63807300 GATGGTTAGCAGAGGCTGGGGGG + Intergenic
1042955016 8:74240416-74240438 GATGGTTACCAGAGGCTGGATGG - Intronic
1042986682 8:74592116-74592138 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1044805621 8:96005555-96005577 GAAGGGAAGGAGAAGGTAGATGG + Intergenic
1045070509 8:98499456-98499478 GACAGTAGGCAGAGGCTAGAAGG + Intronic
1046013224 8:108575251-108575273 GGTGGTGAGCAGAGGCAAGAAGG + Intergenic
1047628285 8:126678819-126678841 GCTGGCAAGCAGAGGCTGGACGG - Intergenic
1047799859 8:128297549-128297571 GATGGTAAGCAGATCAGAGAAGG - Intergenic
1048276721 8:133071624-133071646 GATGGCATGCAGCGGGGAGAGGG + Intronic
1049411294 8:142475138-142475160 GATGGTAAGCAGAGGGTAGAGGG - Intronic
1049497699 8:142944176-142944198 GCTGGAAAACAGAGGGCAGAGGG + Intergenic
1049903871 9:197508-197530 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1050578128 9:7020985-7021007 GATGGTTACCAGAGGCTAGGAGG - Intronic
1051731179 9:20144606-20144628 GATGGATGGCAGAGGGTAGTGGG + Intergenic
1051806376 9:20997178-20997200 GATGGGAAGGAGAGGGAAGCTGG - Intergenic
1052006211 9:23352181-23352203 GATGGTTGGCAGAGGTTTGAGGG - Intergenic
1052435321 9:28420523-28420545 AATGGTATGCATATGGTAGATGG - Intronic
1053080581 9:35173075-35173097 GATGTTGAGAAGAGGTTAGAGGG + Intronic
1053219101 9:36296671-36296693 GAAGGGAAGCAGAGGGTGGAAGG + Intronic
1053462584 9:38282021-38282043 GAGGCTGAGCAGAGGGCAGAGGG + Intergenic
1053746877 9:41207807-41207829 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1053853093 9:42309583-42309605 GATGGTGAGGAGAGGATAGATGG + Intergenic
1054480407 9:65657552-65657574 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1054681467 9:68223474-68223496 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1054828609 9:69598566-69598588 GATAGGAAGCAGAGGGAAGGTGG + Intronic
1055539001 9:77281109-77281131 GATGGTTACCAGAGGGTAGCAGG + Intronic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1057750264 9:97787301-97787323 GGTGGTCAGCTGATGGTAGAGGG - Intergenic
1058759749 9:108119467-108119489 TATGGAGAGCACAGGGTAGAAGG + Intergenic
1060548466 9:124474393-124474415 GGTGGTAAGGAGTGGGTAGAAGG + Intronic
1062556992 9:137117534-137117556 GATGGTCTGGAGAGGGCAGATGG - Intergenic
1202783008 9_KI270718v1_random:18587-18609 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1203742538 Un_GL000218v1:14717-14739 GAATGTGGGCAGAGGGTAGAGGG + Intergenic
1203567560 Un_KI270744v1:104702-104724 GAATGTAGGCAGAGGATAGAGGG - Intergenic
1203582440 Un_KI270746v1:22849-22871 AATGGAAAGCAGAGGTTAGAAGG + Intergenic
1185688341 X:1948485-1948507 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185688619 X:2134007-2134029 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1186137774 X:6537314-6537336 GATGGTTACCAGAGGCCAGAAGG - Intergenic
1186298431 X:8173326-8173348 GATGGTTACCAGAGGCCAGAAGG - Intergenic
1186324345 X:8462579-8462601 GATGGTTACCAGAGGCCAGAAGG + Intergenic
1186796963 X:13056407-13056429 GGTGGTAAGCAGTGGTTTGATGG - Intergenic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1187570558 X:20496431-20496453 GATGGAAAGCAGAGCTCAGACGG - Intergenic
1188986209 X:36770625-36770647 GATGCTCAGCAGAGGGTACATGG - Intergenic
1189745555 X:44165396-44165418 GGTGGTAAACAGTGGGTAGGGGG - Intronic
1189884919 X:45532839-45532861 GATTGGAAGCTGAGGGGAGAGGG - Intergenic
1191147138 X:57178716-57178738 CATGGGAAGCAGAGAGTAGCAGG + Intergenic
1192474413 X:71427551-71427573 AAAAGTAAGCAGAGGGCAGATGG + Intronic
1193338865 X:80322419-80322441 CATTTTAAGCAGTGGGTAGAGGG + Intergenic
1193397197 X:80999636-80999658 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1193422623 X:81301275-81301297 GTTGGTTAGCAGAGGCTAGGTGG - Intergenic
1193744031 X:85253491-85253513 GAAGGTAAGTAAAGGGTACATGG - Intronic
1193808849 X:86026960-86026982 GATGATAAGCAGGAGGTTGATGG - Intronic
1194523877 X:94951960-94951982 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1195208501 X:102627228-102627250 AGTGGTAAGCAGTGGGTACAAGG + Intergenic
1195657841 X:107349423-107349445 AAGGGTACGCACAGGGTAGAGGG - Intergenic
1196033524 X:111117534-111117556 GTTGGTAATCAGATGGTAGCTGG + Intronic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1197180313 X:123528485-123528507 GGTGGTTACCAGAGGCTAGAGGG - Intergenic
1198690143 X:139273788-139273810 GGTGGTTACCAGAGGCTAGAGGG + Intergenic
1199048783 X:143210440-143210462 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1201439115 Y:13989128-13989150 GATGGTTACCAGAGGCCAGAAGG - Intergenic
1201445458 Y:14053580-14053602 GATGGTTACCAGAGGCCAGAAGG + Intergenic