ID: 1049412298

View in Genome Browser
Species Human (GRCh38)
Location 8:142478680-142478702
Sequence CAGGGTGCACAGTGGGACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049412287_1049412298 14 Left 1049412287 8:142478643-142478665 CCATGGGGAAGTGGAGGGTGGGG 0: 1
1: 2
2: 4
3: 79
4: 757
Right 1049412298 8:142478680-142478702 CAGGGTGCACAGTGGGACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049412298 Original CRISPR CAGGGTGCACAGTGGGACTT GGG Intronic
No off target data available for this crispr