ID: 1049414457

View in Genome Browser
Species Human (GRCh38)
Location 8:142488924-142488946
Sequence GCATCTGCCGCCCATCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 210}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049414457_1049414459 -10 Left 1049414457 8:142488924-142488946 CCTTGAAGATGGGCGGCAGATGC 0: 1
1: 0
2: 0
3: 6
4: 210
Right 1049414459 8:142488937-142488959 CGGCAGATGCCAGTGACAGCGGG 0: 1
1: 0
2: 2
3: 14
4: 166
1049414457_1049414460 -9 Left 1049414457 8:142488924-142488946 CCTTGAAGATGGGCGGCAGATGC 0: 1
1: 0
2: 0
3: 6
4: 210
Right 1049414460 8:142488938-142488960 GGCAGATGCCAGTGACAGCGGGG 0: 1
1: 0
2: 0
3: 18
4: 199
1049414457_1049414469 28 Left 1049414457 8:142488924-142488946 CCTTGAAGATGGGCGGCAGATGC 0: 1
1: 0
2: 0
3: 6
4: 210
Right 1049414469 8:142488975-142488997 CCAAGTCCCACCCTGGCTGTGGG 0: 1
1: 0
2: 3
3: 24
4: 218
1049414457_1049414466 21 Left 1049414457 8:142488924-142488946 CCTTGAAGATGGGCGGCAGATGC 0: 1
1: 0
2: 0
3: 6
4: 210
Right 1049414466 8:142488968-142488990 CAGGCTGCCAAGTCCCACCCTGG 0: 1
1: 0
2: 1
3: 31
4: 229
1049414457_1049414463 2 Left 1049414457 8:142488924-142488946 CCTTGAAGATGGGCGGCAGATGC 0: 1
1: 0
2: 0
3: 6
4: 210
Right 1049414463 8:142488949-142488971 GTGACAGCGGGGTCCAGGCCAGG 0: 1
1: 0
2: 2
3: 16
4: 224
1049414457_1049414467 27 Left 1049414457 8:142488924-142488946 CCTTGAAGATGGGCGGCAGATGC 0: 1
1: 0
2: 0
3: 6
4: 210
Right 1049414467 8:142488974-142488996 GCCAAGTCCCACCCTGGCTGTGG 0: 1
1: 1
2: 2
3: 30
4: 268
1049414457_1049414461 -3 Left 1049414457 8:142488924-142488946 CCTTGAAGATGGGCGGCAGATGC 0: 1
1: 0
2: 0
3: 6
4: 210
Right 1049414461 8:142488944-142488966 TGCCAGTGACAGCGGGGTCCAGG 0: 1
1: 0
2: 0
3: 14
4: 171
1049414457_1049414470 29 Left 1049414457 8:142488924-142488946 CCTTGAAGATGGGCGGCAGATGC 0: 1
1: 0
2: 0
3: 6
4: 210
Right 1049414470 8:142488976-142488998 CAAGTCCCACCCTGGCTGTGGGG 0: 1
1: 0
2: 2
3: 22
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049414457 Original CRISPR GCATCTGCCGCCCATCTTCA AGG (reversed) Intronic
900268027 1:1769643-1769665 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
901100132 1:6713494-6713516 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
901473924 1:9476082-9476104 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
901814110 1:11784378-11784400 TCTTCTGCTGCCCATCTTCCTGG - Exonic
902892053 1:19451611-19451633 GCCTCTGTCTCCCATCTGCAGGG - Intronic
903219246 1:21859862-21859884 GCACAGGCCGCCCATCCTCACGG + Exonic
905100322 1:35515227-35515249 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
905257868 1:36696651-36696673 CCATCTGGGGCCCATCTGCAGGG + Intergenic
907607606 1:55834100-55834122 TCATCAGCCTCCCATTTTCACGG + Intergenic
907662838 1:56409149-56409171 GCATCTGCCGCCGCACTGCATGG - Intergenic
907854442 1:58287937-58287959 GCCTCTGCCTCCCAGATTCAAGG - Intronic
911779267 1:101854984-101855006 GCATCTTCTACCCATCTTCATGG + Intronic
916408237 1:164518876-164518898 TCATCTGCTGCCCAACCTCATGG + Intergenic
916641307 1:166730728-166730750 GCATTTGCAGCCCTTCTGCATGG - Intergenic
1064582100 10:16805122-16805144 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1065294482 10:24261411-24261433 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1065945750 10:30604408-30604430 GCATCAGGACCCCATCTTCAGGG + Intergenic
1066336710 10:34485253-34485275 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1067382023 10:45783542-45783564 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1067889721 10:50124185-50124207 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1067957985 10:50814162-50814184 GAGTCTCCCACCCATCTTCAGGG - Intronic
1068748825 10:60567579-60567601 GATTCTGCAGCCCATCATCAAGG + Intronic
1072541168 10:96398952-96398974 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1073044991 10:100631831-100631853 GCAGTTGCCTCCGATCTTCAAGG - Intergenic
1073406019 10:103298720-103298742 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1073676091 10:105648409-105648431 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1074717459 10:116233243-116233265 ACATCTGCCTCCCAGGTTCAAGG - Intronic
1075334872 10:121601403-121601425 ACAGCTCCAGCCCATCTTCAGGG + Intergenic
1075600644 10:123766172-123766194 GCATGTGACACTCATCTTCAAGG - Intronic
1077412923 11:2411767-2411789 GCATCAGCCTCCCATCCTCCAGG - Exonic
1078265713 11:9755203-9755225 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
1081674063 11:44957968-44957990 GCATCTGCCACACTGCTTCATGG + Intergenic
1081708865 11:45204428-45204450 CCATCTGCTTCCCATCTTCCAGG + Intronic
1081935912 11:46903851-46903873 GCATCTGCCAGCCTTCCTCAAGG - Intronic
1082049967 11:47763014-47763036 GCATGAGCCACCCATTTTCAGGG + Intronic
1082819461 11:57534778-57534800 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
1083641952 11:64150432-64150454 GGACCTGCCCCCCATATTCAGGG + Intronic
1084168033 11:67385907-67385929 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1084540824 11:69785880-69785902 ACCTCTGCCGCCCAGGTTCAAGG + Intergenic
1084591595 11:70093736-70093758 GCATCTGTTCGCCATCTTCATGG + Intronic
1086476299 11:87178506-87178528 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1087261960 11:96021891-96021913 GCACCTGGAGCCCAGCTTCAAGG - Intronic
1089503712 11:118948936-118948958 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1093469729 12:19487633-19487655 ACCTCTGCCTCCCAGCTTCAAGG - Intronic
1093854589 12:24085191-24085213 GCATCTGTTGCCCCTCTTCCTGG - Intergenic
1096859299 12:54512046-54512068 GCACCTGCAGCACATCCTCACGG - Exonic
1100836469 12:98571481-98571503 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
1102088155 12:110161221-110161243 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1103654227 12:122457465-122457487 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1103898586 12:124291335-124291357 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1105020833 12:132815814-132815836 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1105608907 13:21950446-21950468 ACCTCTGCCTCCCATGTTCAAGG + Intergenic
1106398786 13:29407558-29407580 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1108075211 13:46672362-46672384 CCATGTGCCACCCATCTGCACGG - Intronic
1108596514 13:51954595-51954617 ACATCTGCAGTCCATCCTCATGG - Intronic
1109865223 13:68255655-68255677 GCATCTCCCTCCCAGGTTCAAGG - Intergenic
1110565793 13:76956593-76956615 GCGTCTGCCTCCCAGGTTCAAGG + Intronic
1112672673 13:101659140-101659162 ACCTCTGCCTCCCATGTTCAAGG + Intronic
1113319300 13:109216578-109216600 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
1113754104 13:112797198-112797220 ACCTCTGCCTCCCAGCTTCAAGG - Intronic
1114457640 14:22866961-22866983 GCATCTGCCTCTCACCTTCAGGG + Intergenic
1120595559 14:86430979-86431001 GCATCTGCAGCCTATTTGCATGG - Intergenic
1121411441 14:93751159-93751181 GCACCTGCAGCCCTTCTTCAGGG + Intronic
1122531955 14:102434539-102434561 GCAGCTCCCGCCCATGTGCATGG - Exonic
1122740627 14:103869790-103869812 GCCCCTGCTGCCCCTCTTCATGG + Intergenic
1122952841 14:105055242-105055264 GCTTCTGCCTCCCAGGTTCAAGG - Intronic
1123101904 14:105809195-105809217 GCAACAGCAGCCCATCTTCCCGG - Intergenic
1125423357 15:39526338-39526360 GCATCTGGCAGCCATCCTCAGGG + Intergenic
1126033416 15:44523077-44523099 GCCTCCGCCTCCCATGTTCAAGG + Intronic
1126897481 15:53274699-53274721 GCATTTCCCACCCATCCTCAGGG - Intergenic
1128698379 15:69786206-69786228 GGATCTACCTCCCATCCTCAGGG + Intergenic
1128964472 15:72044321-72044343 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1130984490 15:88836178-88836200 GCCTCTGCCTCCCCTCTTCCAGG + Exonic
1132663413 16:1071377-1071399 GCCTCTGCCCACCATCCTCATGG - Intergenic
1133214009 16:4279759-4279781 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1135580938 16:23625712-23625734 ACCTCTGCCGCCCAGGTTCAAGG - Intronic
1136161000 16:28418710-28418732 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
1136201964 16:28696281-28696303 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1137880295 16:52039065-52039087 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1138106093 16:54287738-54287760 GGATCGGGCGCCCACCTTCACGG + Intergenic
1138968928 16:62121195-62121217 GCAGCTGCTGCCCTTCTGCATGG + Intergenic
1139964365 16:70737347-70737369 GCAGCTGCCCACCATCTACAGGG - Intronic
1140817227 16:78632639-78632661 ACCTCTGCCTCCCATATTCAAGG + Intronic
1140880962 16:79197785-79197807 GAAACTGCCTCCCATCGTCATGG - Intronic
1141568842 16:84922035-84922057 GCATCTGCGCCCCACCTTCGGGG + Intergenic
1143131282 17:4679107-4679129 CCCTCTGCCTCCCAGCTTCAGGG + Intronic
1143506986 17:7372096-7372118 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1147929489 17:43969023-43969045 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
1148687895 17:49510792-49510814 TCATCTGCCGCCCCACTCCAGGG + Intronic
1149396932 17:56254767-56254789 GGATCTGGGGCCCATGTTCATGG - Intronic
1150046185 17:61915409-61915431 GCATCAGCCTCCCAAGTTCATGG - Intronic
1151072513 17:71232203-71232225 ACATCTGCCTCCCAGGTTCAAGG + Intergenic
1151244041 17:72780511-72780533 CCACCCGCCCCCCATCTTCAGGG - Intronic
1151310328 17:73288772-73288794 GCCTCTGCTGCCCAGCCTCATGG + Intronic
1151517688 17:74606834-74606856 GCATCTGCATCTCACCTTCATGG + Intergenic
1151775407 17:76197955-76197977 GCAGGTTCCTCCCATCTTCAAGG - Intronic
1154132439 18:11749041-11749063 ACCTCTGCCTCCCAGCTTCAGGG - Intronic
1154985334 18:21545488-21545510 GCCTCTGCCTCCCAGGTTCAGGG - Intronic
1157400145 18:47380474-47380496 GCCTCTGCTTCACATCTTCATGG - Intergenic
1158454097 18:57591511-57591533 GCCTCTGCGGCCCTGCTTCATGG + Intergenic
1158939287 18:62392392-62392414 ACCTCTGCCTCCCATGTTCAAGG + Intergenic
1159404428 18:67981660-67981682 ACATCTGCCTCCCAGGTTCAAGG - Intergenic
1161198790 19:3002779-3002801 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1161440665 19:4289956-4289978 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1161674565 19:5637582-5637604 GCCTCTGCCTCCCAGCATCAAGG - Intronic
1162290895 19:9779651-9779673 GCTTCTGCCTCCCAGGTTCAAGG + Intronic
1163171060 19:15531455-15531477 GCATCTGGGGACCATCTCCAGGG + Intronic
1163315655 19:16538890-16538912 GCAACTGGCGCCCAAGTTCATGG + Intronic
1164606445 19:29601907-29601929 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1166328536 19:42065767-42065789 GCATCTTCCTCCCCTCCTCATGG + Exonic
1166928372 19:46285319-46285341 ACCTCTGCCTCCCAGCTTCAAGG - Intergenic
1168024163 19:53631675-53631697 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1168523511 19:57070914-57070936 GCCTCTGCCTCCCGTGTTCAAGG - Intergenic
925202288 2:1978227-1978249 GCATCTGCCGCACATCTGGGAGG - Intronic
926027572 2:9557995-9558017 GCTTCTGCCTCCCAGGTTCAAGG + Intergenic
927473930 2:23397581-23397603 GCAACTGCCTCCCATTTTCCTGG - Intronic
929729093 2:44467447-44467469 ACCTCTGCCTCCCATGTTCAAGG - Intronic
929989348 2:46772216-46772238 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
936524361 2:113232877-113232899 GCACCTGCTCCCCATCATCATGG + Intronic
941022465 2:160423565-160423587 GCACCAGCCACTCATCTTCATGG + Intronic
943827971 2:192420159-192420181 TCATCTGCTTCCCATCTTTAAGG - Intergenic
948764882 2:240214317-240214339 GCAGCTGGCTCCCATCTGCAGGG + Intergenic
1169047813 20:2549658-2549680 ACATCTGCCCCCCAAATTCAAGG - Intronic
1170611364 20:17916283-17916305 ACCTCTGCCTCCCATGTTCAAGG - Intergenic
1172246510 20:33449140-33449162 ACCTCTGCCTCCCAGCTTCAAGG + Intergenic
1172993883 20:39055794-39055816 CCATCTGCCATCCACCTTCAGGG - Intergenic
1173087967 20:39942511-39942533 GCATTTGCTGCCCATCTACTGGG - Intergenic
1173254640 20:41385729-41385751 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
1173647366 20:44641848-44641870 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1173919336 20:46732013-46732035 GCATCTGCCTCCCATTTTTGGGG - Intronic
1177913936 21:27064235-27064257 GTATCTGTCTACCATCTTCAAGG + Intergenic
1178589074 21:33894060-33894082 CCAGCTGCCGCCCAGCTTCTAGG - Exonic
1179886244 21:44315404-44315426 GGACCTGCAGCCCATCTTCCGGG + Intronic
1179909479 21:44440442-44440464 GCATCTGCTTCCCATCTCCTTGG + Intronic
1180053550 21:45345066-45345088 TCATTTGTCTCCCATCTTCAGGG - Intergenic
1180729738 22:17972556-17972578 GCAGCTCACCCCCATCTTCAGGG + Intronic
1183987100 22:41575889-41575911 GCAACAGCCACACATCTTCAGGG - Exonic
951265127 3:20556264-20556286 GCATCTGTAGCTAATCTTCAGGG + Intergenic
954709335 3:52497493-52497515 ACCTCTGCCTCCCAGCTTCAAGG + Intronic
955366063 3:58311235-58311257 GCCTCTGCCTCCCAGATTCAAGG + Intronic
958800626 3:98751122-98751144 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
960517488 3:118618224-118618246 GCAGCTGCTTCCCTTCTTCAAGG + Intergenic
962547451 3:136451678-136451700 GCCTCTGCCTCCCAGATTCAAGG - Intronic
963934108 3:151034852-151034874 ACTTCCGCCACCCATCTTCACGG + Intergenic
966301921 3:178488669-178488691 CCATCTGCTGTACATCTTCAGGG + Intronic
968844637 4:3033667-3033689 GCATCTGCCTCCCGGGTTCAAGG + Intronic
970013525 4:11486873-11486895 ACATTTGCAGCCCAACTTCAAGG - Intergenic
972775767 4:42239011-42239033 AGATCTGCCTCCTATCTTCAAGG - Intergenic
973740024 4:53910672-53910694 GAATCTGCTCCACATCTTCATGG - Intronic
977997688 4:103514928-103514950 GCCTCAGCTGCCCATCTGCAGGG - Intergenic
978250722 4:106628487-106628509 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
981742058 4:148013114-148013136 TAATCTGCCCCCCACCTTCAGGG + Intronic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
987075377 5:14377326-14377348 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
988096467 5:26617821-26617843 ACATCTGCCTCCCAGGTTCAAGG - Intergenic
990573423 5:57101922-57101944 ACATCTGCCTCCCAGGTTCAAGG - Intergenic
991084288 5:62634468-62634490 GCCTCTGCCACCCAGGTTCAAGG + Intergenic
994090098 5:95802420-95802442 GCTTCTGCCTCCCAGGTTCAAGG + Intronic
996942552 5:129026007-129026029 GCATCTGCAGCCCAGCTACTTGG + Intronic
997668078 5:135648270-135648292 GCATCTGCTGCACAACTCCAAGG - Intergenic
997946882 5:138210441-138210463 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
997971795 5:138409447-138409469 GCTTCTGCCTCCCAGGTTCAAGG - Intronic
998363506 5:141611982-141612004 GCCTCTGCCTCCCAGGTTCAAGG - Intronic
999341210 5:150775008-150775030 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
999755633 5:154662506-154662528 GCCTCTGCCTCCCAAGTTCAAGG + Intergenic
1001577791 5:172775436-172775458 GCCTCTGCCTCCCAGCTTCCTGG + Intergenic
1002210274 5:177594907-177594929 GCCTGTGCCCACCATCTTCAAGG + Intronic
1002503408 5:179662230-179662252 GCATGTGCCTCCCATCTACTTGG - Intergenic
1003466144 6:6382001-6382023 GCATCTGCAGCCCATTTTAGAGG + Intergenic
1004123265 6:12846885-12846907 GCTTCTGCCTCCCATGCTCAAGG + Intronic
1004214203 6:13686366-13686388 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1004680101 6:17885505-17885527 GCATTTGCTGCACATCTACAAGG + Intronic
1004753750 6:18589368-18589390 ACATCTGCCTCCCAGGTTCAAGG + Intergenic
1005249446 6:23927772-23927794 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1005322170 6:24666425-24666447 GCATCGTCCGCCCAGCTCCACGG + Intronic
1006073142 6:31511320-31511342 ACATCTGGCGCCAATATTCAGGG + Intergenic
1008498677 6:52157923-52157945 GCATCTGCCTCTCAGCTTTAAGG + Intergenic
1010980702 6:82365516-82365538 GGTTCTGCCGCTCATCTTCAGGG - Exonic
1011275143 6:85623479-85623501 GCCTCTGCCTCCCAGATTCAAGG - Intronic
1013586287 6:111581893-111581915 GCCTCTGCCTCCCAAGTTCAAGG - Intronic
1017893937 6:158663184-158663206 GCCTCCGCCGCTCATCTGCAGGG + Exonic
1019459843 7:1151807-1151829 GCACCTCCGGGCCATCTTCACGG - Intergenic
1019460160 7:1153991-1154013 GCACCTCCGGGCCATCTTCACGG - Intronic
1020012242 7:4812502-4812524 GCCTCTGCCCCCCAGGTTCAAGG + Intronic
1020182861 7:5935677-5935699 GCCTCTGCCTCCCAGGTTCAGGG - Intronic
1020300051 7:6789080-6789102 GCCTCTGCCTCCCAGGTTCAGGG + Intronic
1021625197 7:22586325-22586347 GCATCAGCCTCTCACCTTCAGGG + Intronic
1022120720 7:27305487-27305509 TCATCTGCCACTCATCTTCAAGG + Intergenic
1022169656 7:27813178-27813200 GCATCTCCCTGCCATCTTCCAGG + Intronic
1024737856 7:52324309-52324331 ACCTCTGCCTCCCATGTTCAAGG + Intergenic
1028757929 7:94459368-94459390 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1029150216 7:98475038-98475060 GCCTCTGCCTCCCAGGTTCAAGG - Intergenic
1029356399 7:100055345-100055367 ACCTCTGCCTCCCATGTTCAGGG + Intronic
1030999847 7:116402155-116402177 ACTTTTGCCGGCCATCTTCAAGG + Intronic
1032224012 7:130016134-130016156 GCATCTCCCACTCATCTCCAAGG + Intergenic
1035260451 7:157658609-157658631 GCTGCTGCCGCTCACCTTCAGGG + Intronic
1038041729 8:23728778-23728800 GCATCCACCTCCCATGTTCAAGG - Intergenic
1044949035 8:97417927-97417949 ACCTCTGCCTCCCATGTTCAAGG + Intergenic
1047594534 8:126365138-126365160 TCATATACCGCCCATCCTCATGG - Intergenic
1049414457 8:142488924-142488946 GCATCTGCCGCCCATCTTCAAGG - Intronic
1049571422 8:143371926-143371948 GCATGGGCCGCCCACCTCCAAGG + Intronic
1050944315 9:11498714-11498736 ACATCTGCCTCCCAGGTTCAAGG - Intergenic
1052798456 9:32945943-32945965 GCATCTGCCATCTGTCTTCATGG - Intergenic
1053114962 9:35491888-35491910 ACATCTGCCTCCCAGGTTCAAGG - Intronic
1056464378 9:86839337-86839359 GCATCTGCCGGCCCTCCCCAGGG - Intergenic
1058888853 9:109343804-109343826 GCCTCTGCCTCCCAGGTTCAAGG + Intergenic
1059147194 9:111910826-111910848 GCCTCTGCCTCCCAGGTTCAAGG + Intronic
1061048598 9:128180881-128180903 GCAGCTGCCCCCCATCCTCCAGG + Intronic
1061793516 9:133071067-133071089 GGAGCTGCTGCCCATCTTCTTGG - Exonic
1061796125 9:133086866-133086888 GGAGCTGCTGCCCATCTTCTTGG - Intronic
1187006201 X:15234899-15234921 GCATCAGCCCTCCATATTCATGG + Intergenic
1187264146 X:17715907-17715929 GAATCTGCAGACCATCTGCAGGG + Intronic
1194898049 X:99469520-99469542 GCATCTGGAGCCCATTTTCCTGG + Intergenic
1195257230 X:103102429-103102451 GCCTCTGCCTCCCAGGTTCAGGG - Intergenic
1195738989 X:108043076-108043098 TCTTCTGCCTCCCACCTTCACGG - Intergenic
1199634082 X:149798865-149798887 GCCTCTGCCTCCCATGTTCAAGG - Intergenic
1202031086 Y:20575186-20575208 GCCTCTGCCGCCCAAATTCCTGG - Intergenic