ID: 1049414598

View in Genome Browser
Species Human (GRCh38)
Location 8:142489446-142489468
Sequence CATCAGAGTGTGCACGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049414598 Original CRISPR CATCAGAGTGTGCACGTGGA CGG (reversed) Intronic
900307963 1:2020052-2020074 CCTGAGTGTGTGCAGGTGGACGG + Intronic
900566765 1:3336343-3336365 CATGTGTGTGTGCATGTGGAGGG + Intronic
900918002 1:5651751-5651773 CATCACTGTGCCCACGTGGAAGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902472186 1:16656818-16656840 CATCAGGCTGGGCAGGTGGAGGG + Intergenic
902486617 1:16750628-16750650 CATCAGGCTGGGCAGGTGGAGGG - Intronic
902504457 1:16930241-16930263 CATCAGGTTGGGCAGGTGGAGGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907274099 1:53307550-53307572 CACCTGAGTGTGCAAGTGGGTGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910213797 1:84821311-84821333 CCTCAGTGTGTGGACGTGTATGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG + Intergenic
918849570 1:189668898-189668920 CATCAAAGTGTTCAAGTGAAAGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922791015 1:228311111-228311133 CATCAGAGTGGGCAACTGTATGG + Intronic
1062938031 10:1402355-1402377 AAGCAGAGTGGGCACGTGGCAGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065317512 10:24478210-24478232 CTTCAAAGTATGCATGTGGAAGG - Intronic
1066443710 10:35462657-35462679 TCTCAGAGTGTGCGGGTGGAGGG + Intronic
1067390876 10:45862408-45862430 CATCAGTGTGTGCACAAGCATGG - Intergenic
1067872404 10:49973698-49973720 CATCAGTGTGTGCACAAGCATGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070138061 10:73712626-73712648 CATCAGTGTGTGCACAAGCATGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074409057 10:113209118-113209140 CATCAGAGCATGCACGTATATGG + Intergenic
1077176660 11:1194199-1194221 CAGCAGATTGTGCCCGTGTATGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079355600 11:19727868-19727890 CTCCAGAGTCTGCACGAGGAAGG + Intronic
1081602452 11:44504811-44504833 CCTCAGAGTCTCCATGTGGAGGG - Intergenic
1081760946 11:45576080-45576102 CATCAGAATGAGCACTTTGAGGG - Intergenic
1083437054 11:62649749-62649771 CATGAGAGGGTGGAGGTGGACGG + Exonic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087587702 11:100142867-100142889 CCACAGATTGTCCACGTGGATGG + Intronic
1088694954 11:112358762-112358784 CATCAGACTGAGCACCTTGAGGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092722422 12:11454930-11454952 TATCAGAGGGTGAAGGTGGAAGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095988403 12:48016353-48016375 CATCTGAGTGTGCCCTTGGCTGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098609304 12:72434796-72434818 CATCAGAGTGTGAAAGTGTTGGG - Intronic
1102752734 12:115309785-115309807 TATCAGAGGCTGCAGGTGGATGG - Intergenic
1103398498 12:120626086-120626108 CACCCGAGTGTGCACTTGAAGGG + Intergenic
1103586621 12:121961041-121961063 CCTCCCAGTGTGCACGGGGAGGG + Intronic
1105792964 13:23820773-23820795 CATCAGAGTGTGCATTTCTAAGG + Intronic
1113268144 13:108642262-108642284 CATGAGACTGTGGACGTGAAAGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1118467566 14:66044886-66044908 TAGCAGAGTGTGCAAGTGTAGGG + Intergenic
1118992046 14:70806223-70806245 CATCAGAGGGTGAACATGGGCGG - Intronic
1119439952 14:74621566-74621588 CCACAGAATGTGCATGTGGAGGG + Intergenic
1121273944 14:92655421-92655443 CATTAGTGAGTGCATGTGGATGG + Intronic
1121898416 14:97670560-97670582 CAGCTGAGCGTGGACGTGGATGG + Intergenic
1122102613 14:99425285-99425307 TACCAAGGTGTGCACGTGGATGG - Intronic
1122186825 14:100005491-100005513 CATCAGAGGGTGCAAGAGAAAGG + Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1124362771 15:29050845-29050867 CATCAAGCTGTGCACGTTGAAGG - Intronic
1124581658 15:30961144-30961166 CATCAGAGTATGCATGTGACAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126969954 15:54099536-54099558 CATCAGAATGTGAACATGAATGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1132060553 15:98688910-98688932 CATCAGTATATGCATGTGGATGG + Intronic
1133855107 16:9542349-9542371 CAGCAGAGTGTGTAAGTGTATGG - Intergenic
1133916688 16:10115486-10115508 CCCCAGGGTGTGCACATGGATGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137697378 16:50470158-50470180 GATCAGAGTGTGCAAGGTGATGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1142348521 16:89569422-89569444 CATCAGAGTGGGCAGGGGGAGGG + Intergenic
1142503245 17:345746-345768 CAGCAGGGTGTGCACGCAGATGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1150421604 17:65041642-65041664 CGTCTGTGTGTGCACGTGGAAGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1153350853 18:4079721-4079743 AATCAGTGTGTGTATGTGGAGGG + Intronic
1155024940 18:21932830-21932852 CATCATAGTGTGGGCCTGGAGGG - Intergenic
1158623391 18:59051427-59051449 CATCTCAGTGGGCACGTGGCGGG - Intergenic
1160325375 18:77942105-77942127 CCTCAGAGTGTGCACTAGGGTGG + Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163157751 19:15448786-15448808 GATCAGAGTGTACAAGTGGCTGG - Intronic
1164873442 19:31666596-31666618 CATCAGAAAGTGAAGGTGGATGG - Intergenic
1165393570 19:35551702-35551724 CATCAGAGTGTGGGGGTGGGGGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1202704582 1_KI270713v1_random:13612-13634 CATCAGGCTGGGCAGGTGGAGGG + Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
934559606 2:95306274-95306296 CACCAGAGAGGACACGTGGATGG - Intronic
934948274 2:98557915-98557937 CAACAGAGTGTACAGGAGGAAGG - Intronic
935172275 2:100619695-100619717 CATCACAGTGTCCACCTGGGAGG - Intergenic
935570024 2:104649785-104649807 CAACTGAGTGTGAAAGTGGAGGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935639641 2:105278734-105278756 CTTGAGAGTGTGCCCTTGGAGGG - Intronic
936907636 2:117555479-117555501 CAGCAGAGTGTGCAAGTCCAGGG + Intergenic
937436542 2:121886309-121886331 CATCAGACTGTACAAGTGAAGGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938632566 2:133183987-133184009 ATTCAGAGTGTACACGTGCAGGG + Intronic
938984435 2:136560283-136560305 CAACAGAATCTGCACGTAGAAGG + Intergenic
939437751 2:142200462-142200484 CATCTGACAGTGCAGGTGGATGG - Intergenic
939716819 2:145594399-145594421 CATGAGGGTGTGGACTTGGATGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944050928 2:195468597-195468619 GATTAGAGTGAGCACCTGGAGGG + Intergenic
944068166 2:195641261-195641283 AATCAGAGGGTGCAAGGGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
948583546 2:239004236-239004258 CATCAGAGTGTGCCCCTAGTTGG + Intergenic
948810016 2:240469730-240469752 CAGAAGTGTGTGCACGTGTATGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1172097421 20:32467251-32467273 CATCAGTGTGGGCACCTGGATGG + Intronic
1172861320 20:38054855-38054877 CATCAAAGTGGTCATGTGGAAGG - Intronic
1180128152 21:45805841-45805863 CATCCGAGTGTGCAGGTGCTAGG - Intronic
1180834498 22:18923079-18923101 CACCAGACTCTGCAGGTGGAAGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182634701 22:31716314-31716336 CTTCAGAGTGTCCACCAGGATGG + Exonic
1182842455 22:33402462-33402484 CATCAAAGTGTGCACTGGGGAGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1185032669 22:48452930-48452952 CATCAGCTTGTGCACGAGGGTGG - Intergenic
1185067038 22:48637685-48637707 CATCTGTGTGTGCACGTGTGGGG + Intronic
1203284587 22_KI270734v1_random:148378-148400 CACCAGACTCTGCAGGTGGAAGG + Intergenic
950636330 3:14317774-14317796 CAGCAGAGAGTGCACAGGGATGG - Intergenic
952261866 3:31747939-31747961 CAGCAGAGTGTGCACCAGGCGGG - Exonic
953336378 3:42097868-42097890 CATCAGAGTGTGCTCTGGGAAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
956125330 3:66005635-66005657 CATCAGTGTGTGTGAGTGGAAGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961647776 3:128401529-128401551 CATCAGAGTGTGAGCATGGCAGG + Intronic
961651948 3:128421167-128421189 CAACAGAGTGTGGGCCTGGAGGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971470618 4:27021976-27021998 CATCAGAGTATGGCAGTGGAGGG - Intronic
971909965 4:32783259-32783281 CCTCAGTATGTGCACATGGAGGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976391936 4:84514582-84514604 AATCAGAGTTTGCACATGAAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978822347 4:112980186-112980208 CAGCAGGGTGTGCACGTGCTGGG - Intronic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982482181 4:155925448-155925470 CAGCAGAGTGACCACGTAGAAGG - Exonic
983504447 4:168537277-168537299 CATCACAGTTTGCACTTGAAAGG - Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985610696 5:886395-886417 GGTCAGAGAGTGCACGTGGCCGG + Intronic
985911894 5:2891033-2891055 CATCAGTGTGTGCACTTGTGTGG - Intergenic
986304105 5:6502821-6502843 CATCAGAGTGTGGCTGTGGGGGG - Intergenic
987230129 5:15885290-15885312 CATCAGAGTGAGCAAGTGAGAGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992266440 5:75022941-75022963 CATCTGAGAGTGCGCTTGGAAGG - Intergenic
996108618 5:119538070-119538092 CATCAGAGTGGTCAAGTAGAGGG - Intronic
1002277882 5:178114939-178114961 CAGCAGTGTGTGCCCATGGAGGG + Intronic
1006155510 6:32011011-32011033 CCTCAGAGTGTGCAGGTGGACGG - Intergenic
1006161843 6:32043865-32043887 CCTCAGAGTGTGCAGGTGGATGG - Exonic
1006339963 6:33441507-33441529 CCTCTGAGGGTGCAGGTGGAGGG - Intronic
1007250419 6:40491299-40491321 CATCTTAGAGTGCACCTGGAGGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008634105 6:53392406-53392428 CATCAGATCCTGCAGGTGGATGG + Intergenic
1012993055 6:105946011-105946033 CATCAGAGTTTGGAGGTGGAGGG - Intergenic
1013275308 6:108579372-108579394 CATCAGAAGGTCCACATGGAAGG + Intronic
1014663467 6:124203591-124203613 CATTAGAGTGTACAGGTGGTTGG + Intronic
1018790234 6:167142912-167142934 CATCTGATTGTGCACTAGGATGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1030661139 7:112220961-112220983 CAGAAGAGTGTGCAGTTGGAAGG - Intronic
1033323298 7:140359397-140359419 CCTCAGACTGTGCATGTGGAGGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033347203 7:140534698-140534720 CTGCAGAGTGTGGAGGTGGAGGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035231838 7:157470061-157470083 AATCAGAGTGTGCAAGTGACTGG - Intergenic
1037263388 8:17033113-17033135 CCTCTAAGTGTTCACGTGGAAGG + Intronic
1037447678 8:18983516-18983538 CCTCTAAGTGTTCACGTGGAAGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041600443 8:59711406-59711428 CCTCTGTGTGTGCATGTGGAGGG - Intergenic
1043501295 8:80859989-80860011 CACGAGTGTGTGCACGTGTAGGG - Intronic
1044749472 8:95402325-95402347 CATCAGAGCGTGGACTAGGAAGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1049414598 8:142489446-142489468 CATCAGAGTGTGCACGTGGACGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051853168 9:21532535-21532557 CCTCAGTGTGTGCATGTGGAAGG - Intergenic
1052733668 9:32318576-32318598 CATCAGATAGTCCACCTGGAAGG - Intergenic
1055002837 9:71472982-71473004 CATCAGAGACTGCACGTTGTGGG - Intergenic
1058421582 9:104837904-104837926 CATGAGAGTGTGAATCTGGATGG - Intronic
1058551460 9:106119915-106119937 AATGAGAGTGTGCACATGAAGGG + Intergenic
1187829621 X:23367643-23367665 CATCCGAGTCTTGACGTGGAAGG + Intronic
1187972628 X:24674067-24674089 CATCCAACTGTGCAAGTGGAAGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189402856 X:40688487-40688509 CATCAAGGAGTGCAAGTGGAAGG - Exonic
1189617527 X:42799166-42799188 TATCAGAGTGTGCTCTTGGATGG + Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1192214162 X:69146625-69146647 AAACAGAGTGTGGACCTGGAGGG + Intergenic
1192872154 X:75194933-75194955 CATCAGAGTGTCCAAGGGCATGG - Intergenic
1198177552 X:134171914-134171936 AATGAGGGGGTGCACGTGGAGGG - Intergenic
1198700528 X:139392654-139392676 CATGTGTGTGTGCACATGGAAGG - Intergenic