ID: 1049415522

View in Genome Browser
Species Human (GRCh38)
Location 8:142493174-142493196
Sequence CTGCTGCCCTGGAGGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 265}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049415522_1049415537 26 Left 1049415522 8:142493174-142493196 CCCTTTGTCCTCCAGGGCAGCAG 0: 1
1: 0
2: 2
3: 26
4: 265
Right 1049415537 8:142493223-142493245 GGGACAAGGACACTGCCCCAGGG No data
1049415522_1049415536 25 Left 1049415522 8:142493174-142493196 CCCTTTGTCCTCCAGGGCAGCAG 0: 1
1: 0
2: 2
3: 26
4: 265
Right 1049415536 8:142493222-142493244 CGGGACAAGGACACTGCCCCAGG No data
1049415522_1049415530 5 Left 1049415522 8:142493174-142493196 CCCTTTGTCCTCCAGGGCAGCAG 0: 1
1: 0
2: 2
3: 26
4: 265
Right 1049415530 8:142493202-142493224 GAGGGGCCTGTCCAGTGAGCCGG No data
1049415522_1049415533 12 Left 1049415522 8:142493174-142493196 CCCTTTGTCCTCCAGGGCAGCAG 0: 1
1: 0
2: 2
3: 26
4: 265
Right 1049415533 8:142493209-142493231 CTGTCCAGTGAGCCGGGACAAGG No data
1049415522_1049415531 6 Left 1049415522 8:142493174-142493196 CCCTTTGTCCTCCAGGGCAGCAG 0: 1
1: 0
2: 2
3: 26
4: 265
Right 1049415531 8:142493203-142493225 AGGGGCCTGTCCAGTGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049415522 Original CRISPR CTGCTGCCCTGGAGGACAAA GGG (reversed) Intronic
900093758 1:931931-931953 TTGCTGCCCTGGAAGCCACAGGG - Intronic
900584149 1:3424485-3424507 CTGATGCCGTGGAGGCCAGATGG + Intronic
900630224 1:3631182-3631204 GTGCTGGCCTGCAGGACAAGGGG - Intronic
901069059 1:6508240-6508262 CTGCAGCCCTGGATGCCAAGAGG + Intronic
901357439 1:8663587-8663609 TGGCTGCACTGGAGGACAGATGG - Intronic
902225683 1:14995093-14995115 CAGCTGCCCTGGAGGAAGAGGGG + Intronic
903860792 1:26363297-26363319 CTGCTGCCCTGTAGGGGAGATGG + Intronic
904398196 1:30237161-30237183 CTGCTGCACAGGAGAACAGAAGG - Intergenic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
906071629 1:43021139-43021161 CTGTTGCCCTGGAGGAGCACAGG - Intergenic
915712763 1:157917114-157917136 CTGCTGCCAGGGAGGGTAAATGG - Intergenic
915834791 1:159168178-159168200 CTCCTGCCCGGGAGGGAAAAGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918511637 1:185318903-185318925 CTGCTGGCCTGTTGGACACATGG + Intergenic
918590636 1:186237216-186237238 CTGTTGCTCTGGAGGACATCTGG - Intergenic
920086956 1:203424416-203424438 ATGCTGGCCTGGAAGACAGAAGG - Intergenic
920301262 1:204990469-204990491 CTGCAGCCCCAGGGGACAAAAGG + Intronic
920399502 1:205668328-205668350 CGCCTTCCCTGGAGCACAAACGG + Intronic
920546303 1:206821650-206821672 CTGCTGCAGTGGAAGACAATAGG - Intronic
922566735 1:226606059-226606081 CTTTTCCCCTGGAGGGCAAAGGG + Exonic
924368342 1:243320460-243320482 CAGCAGCCTTGGAGGGCAAAAGG - Intronic
1062979798 10:1712637-1712659 CTCCTTCCCTGGGGGACAGAGGG - Intronic
1063201222 10:3786074-3786096 CTGGTGGCCCGGAGGACAGAGGG - Intergenic
1063368041 10:5503088-5503110 CTGCCACCCTGGAGGAGAAAGGG + Intergenic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1068015895 10:51516009-51516031 CTTCTGCCAGGGAGGTCAAAGGG + Intronic
1069724940 10:70571493-70571515 CTGCTGCCCTGGTGGAGACCCGG + Intergenic
1069944628 10:71977327-71977349 CTACTGCCCTGCAAGACAAGAGG - Intronic
1071565679 10:86670235-86670257 CTACTGCCCTGGAGACCACAGGG + Intronic
1071724826 10:88187622-88187644 CAGCTGTCCTGGAGGACAAGTGG + Intergenic
1072611377 10:97019511-97019533 CTGCTGACTAGGAGGACAGAAGG + Intronic
1074109966 10:110415881-110415903 CTTCTGCCCTGGTGCAGAAACGG + Intergenic
1075309832 10:121404934-121404956 CAGCCCTCCTGGAGGACAAACGG + Intergenic
1075330257 10:121568910-121568932 GTGCTGCCCTGGACGAGAAGAGG + Intronic
1076133671 10:128030214-128030236 CTGCTGCCCTGGCGAACAACGGG + Intronic
1076374467 10:129973817-129973839 CTGCTGCTCTGGAAAAGAAAAGG + Intergenic
1076886863 10:133267016-133267038 CTGGGGCCCTGCAGGACAGATGG - Intronic
1077094589 11:793926-793948 CTCCCTCCCTGGAGGACAGATGG + Intronic
1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1077378523 11:2216645-2216667 CTGGTGCCCTCCAGGAGAAAGGG - Intergenic
1078144968 11:8716282-8716304 CTGCTCCCATGGAGAACACAGGG + Intronic
1078563018 11:12389634-12389656 TTGTTGCCCTGGAGGGGAAATGG - Intronic
1078781283 11:14441525-14441547 CAGCTACCCTGGAGGAGAAGAGG + Intergenic
1079635818 11:22739213-22739235 CTTCTGGCCTGGAAGACAAATGG + Intronic
1083019354 11:59490554-59490576 ATGCTGCTGTGGAGGTCAAAAGG - Intergenic
1083619036 11:64039919-64039941 CTGAAGCCATGGAGGATAAATGG + Intronic
1084670388 11:70603365-70603387 CTGCTGCCCCAGAGGAGGAAGGG - Intronic
1084738694 11:71123440-71123462 CTGCTGCCCAGGAATACAGAGGG + Intronic
1085551296 11:77375379-77375401 CTACTGCCCACAAGGACAAAAGG + Intronic
1087056542 11:93942039-93942061 CTCCAGCCCTGGAGGTCAGAGGG + Intergenic
1087783017 11:102320922-102320944 TTGCTGCCCTGCAGGACTATAGG + Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089602887 11:119626015-119626037 CTGCTGCCCTGAAGGGCAGGGGG - Intronic
1089796907 11:120988092-120988114 CTGCCGTCCTGGGGGCCAAATGG + Exonic
1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1091902600 12:4156615-4156637 ATGCTGCCCTGGGGCTCAAAAGG - Intergenic
1092088585 12:5785833-5785855 CTGCTGGCCTGGAGGGTAGATGG - Intronic
1093026424 12:14249504-14249526 TTCATGCCCTGGATGACAAAGGG + Intergenic
1095852961 12:46831015-46831037 CTGCTGACTTGGAGGAAAAGGGG - Intronic
1100667698 12:96772421-96772443 CTGCTGGCTTGGAAGATAAAGGG - Intronic
1101738587 12:107482303-107482325 CTCCTGGCCTGGAGAACAAGAGG + Intronic
1101881362 12:108628374-108628396 CTGCTGCCCTGAAGGCAAATTGG - Intronic
1103661105 12:122518214-122518236 CTTGAGCCCTGGAGGACAAGAGG + Intronic
1103736825 12:123065876-123065898 CTGCTGTCCAGGATGACAGAGGG - Intronic
1104004511 12:124882626-124882648 CTGCTGCTCTGGAGAACACCTGG - Intronic
1106244175 13:27933228-27933250 CCACTGGACTGGAGGACAAAGGG - Intergenic
1106567068 13:30895459-30895481 CAGCTGCCCTGGGTGACATAGGG + Intergenic
1108065850 13:46577029-46577051 CTGCTGGCCTGAAAGAAAAAAGG - Intronic
1108465960 13:50715535-50715557 ATGTTGCCCTGGAGGACTCAGGG + Intronic
1108924852 13:55729406-55729428 CTACTTCCCAGGAAGACAAAGGG + Intergenic
1110357761 13:74588195-74588217 CTGCTGGCCTGGACGACTGAAGG + Intergenic
1113891964 13:113740853-113740875 CTCCTCCCCTGGAGGAGAAACGG + Intergenic
1114695937 14:24627845-24627867 CTGTGGCCCTGGAGGAAAAGAGG + Intergenic
1114799400 14:25755940-25755962 TTGCTGCCCTCCAGGTCAAATGG - Intergenic
1117025567 14:51616547-51616569 CTGCTGCTGAGGAGGAAAAAAGG - Intronic
1119678974 14:76577707-76577729 CTTCTGGTCTGAAGGACAAATGG - Intergenic
1119775637 14:77246685-77246707 CAGCAGCCCTGGTGGACACATGG - Intronic
1121123823 14:91393228-91393250 GGGCAGCCCTGGAGGACAAGAGG + Intronic
1122810103 14:104283506-104283528 CTGCTGCCCGGGAGGGCGGAGGG + Intergenic
1122856956 14:104564442-104564464 CTCCATCCCTGGAGGGCAAATGG + Intronic
1122994392 14:105254993-105255015 CTGCTGCCCAGGAAGAGAGATGG - Intronic
1124249710 15:28098887-28098909 ATGCTGCCCTGGAGTTCAAGTGG + Intronic
1126431880 15:48594474-48594496 CTGCTCCCCTTCAGGAAAAAGGG - Intronic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1126913382 15:53438232-53438254 CTGCTGCCCAGGAAGAAAAGGGG + Intergenic
1129664563 15:77572362-77572384 ATGCTCCCCTGGAGTACAAGGGG - Intergenic
1129670591 15:77605754-77605776 CAGCTGCCCTGCAGGAGAAAGGG + Intergenic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1134666613 16:16023612-16023634 CCACTGCCCTGGAGGAGAGATGG + Intronic
1135937854 16:26796318-26796340 CTGCTGCCCTGCTGGTCAGAAGG - Intergenic
1136059833 16:27718889-27718911 CAGCTGCGGTGGAGGACAAAGGG - Intronic
1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG + Intronic
1137330666 16:47492408-47492430 CTGCTGATCTGGTGGAGAAAAGG + Intronic
1138062038 16:53902032-53902054 TTGCTCCCCTAGAGAACAAATGG + Intronic
1138657197 16:58498310-58498332 CTGCTGCCCTGGGGAGCACAGGG + Intronic
1139558026 16:67724961-67724983 TGGCTGCCCTGGAGGAGGAAAGG - Exonic
1140742522 16:77954226-77954248 CTGTTGCCCTGGAGTGAAAAGGG + Intronic
1140875692 16:79150753-79150775 CGGCTACCCAGGAGGCCAAAGGG - Intronic
1141599827 16:85118894-85118916 CTGCTGGCCTGGAGGAAGATGGG - Intergenic
1141685156 16:85565897-85565919 CTGCTGCCCTGGAACCCACAGGG - Intergenic
1142670255 17:1484812-1484834 CAGGTGCTTTGGAGGACAAATGG + Intronic
1144160649 17:12554367-12554389 TTGGTGCCCTGGAGAAGAAATGG + Intergenic
1144261031 17:13521065-13521087 CTGCTGCCATGTAGAAAAAAGGG - Intronic
1144485586 17:15661586-15661608 CTGATGCCCTGCAGTCCAAATGG + Intronic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1147234563 17:39047715-39047737 CTGCTGCCCTCCAGAAGAAAGGG + Intergenic
1147626812 17:41905716-41905738 CTGGTGCCTGGGAGGACACACGG + Intronic
1147927621 17:43955189-43955211 CACCTGCCCAGGAGGAGAAAGGG + Intronic
1148044449 17:44734174-44734196 CTGCTGAACTGAAGGACAAATGG + Intronic
1148480442 17:47956528-47956550 CTTCTGCCCAGGAGGACATGTGG + Intronic
1148636989 17:49156551-49156573 CTGGAGGCCTGGAGGACACAGGG - Exonic
1149434992 17:56626114-56626136 CTGGTGCCCAGGAGGACAAGGGG - Intergenic
1149543761 17:57488077-57488099 CTGCTGCCCTGGGCTCCAAATGG - Intronic
1150649523 17:67000794-67000816 CTGCTGACTTGGAGCAGAAAGGG - Intronic
1150835412 17:68559106-68559128 CTTCTGACCTATAGGACAAATGG + Intronic
1152132384 17:78485108-78485130 CTGCTTCCCCGGAGGACAGAAGG + Intronic
1152138064 17:78517544-78517566 CTGCTGCCTAGGAGGCCACATGG + Intronic
1153655292 18:7276969-7276991 CTGCTTCCCATGAGGTCAAACGG - Intergenic
1155065175 18:22263357-22263379 CACAGGCCCTGGAGGACAAAAGG - Intergenic
1156264340 18:35472669-35472691 CTGCTTCTTTGGAGGACAATTGG - Intronic
1158713775 18:59860183-59860205 CAGCTGTCCTGGAAGACAGATGG - Intergenic
1159295888 18:66487912-66487934 CTGCTGCCCTGGAATTCACAAGG + Intergenic
1159953851 18:74505955-74505977 CTGCAGCCCTGGAGGACGGCTGG + Exonic
1160238037 18:77101217-77101239 CAGCTGCCCTGGAGAACCCAGGG - Intronic
1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG + Intronic
1161615104 19:5265723-5265745 CTGCTGCCCTGGGAGACACTGGG + Intronic
1161680632 19:5678088-5678110 CTGCTTCCCTGCGGGACACAGGG - Intronic
1161686991 19:5707819-5707841 CTGACTCCCTGGGGGACAAAGGG + Exonic
1162759202 19:12878572-12878594 CTGCTTGCCTGGAGGACAAGGGG + Exonic
1163554162 19:17983152-17983174 CTGAGGCTCTGGGGGACAAAGGG + Intronic
1163598068 19:18231954-18231976 CTGCTCCCCTGTAGGAGGAAGGG - Intronic
1165185486 19:34017191-34017213 CTGCTGTCATACAGGACAAATGG - Intergenic
1165757005 19:38299468-38299490 CTTCTCCCCTGTAGGAAAAAGGG - Intronic
1167762499 19:51458341-51458363 CCCCTGCTCTGGGGGACAAAGGG - Exonic
925271886 2:2615806-2615828 TTGTTGCCCTGTAGGTCAAAGGG + Intergenic
925841157 2:7993818-7993840 CTTCTGCCCTGGATAACGAAGGG + Intergenic
926309646 2:11666236-11666258 CTGCTGCCCCAGAGGCCACAGGG + Intronic
927786925 2:25980985-25981007 TTGCTGCCCTGGCGGGCAACAGG - Exonic
929218003 2:39436725-39436747 CTGCTGCCTTGGTGAACAAAGGG - Intronic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930004296 2:46883577-46883599 ACTCTGCCCTGGATGACAAAGGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
935975150 2:108570815-108570837 GTCCTGCCCTGGAGGGGAAAGGG + Intronic
936563532 2:113563240-113563262 CCACTGCCCTGGAGGACCAGGGG + Intergenic
936733126 2:115407531-115407553 CTGCTGGCCTGAAGGAGAGAAGG + Intronic
937228679 2:120384369-120384391 CTGCTGCCCTGAAGGATACCTGG + Intergenic
938686427 2:133742417-133742439 CAGAGGCCCTGGAGGAAAAAGGG - Intergenic
942624867 2:177889227-177889249 CTCCTGTGCTGGAGGACAATGGG - Intronic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
943599994 2:189905533-189905555 CTGCAGACCTTGAAGACAAAAGG - Intronic
943643915 2:190387692-190387714 CTGCTGCCGTGGATGATATATGG + Intergenic
944205037 2:197149614-197149636 CTGCTGCTTTGGAGAACTAAAGG - Intronic
944521345 2:200571653-200571675 CTGATGTCCTGGATGGCAAAAGG + Exonic
945434942 2:209808678-209808700 CTGCTCCCCTGGAGTACTTAAGG + Intronic
945966549 2:216193575-216193597 CTTCTGCACTGGAGAACAAAAGG + Intronic
946355552 2:219182266-219182288 ATGCTCCCCTGGAGGACCAGTGG + Exonic
946988375 2:225300647-225300669 TTGCTGCCATGGAGGGCAAGTGG + Intergenic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
947983502 2:234429269-234429291 CTGCTGACTTGGAGGAGAAAGGG - Intergenic
948565304 2:238882570-238882592 GTGCTGCCTTGGAGGCCAATCGG - Intronic
1169063273 20:2677005-2677027 CTCCTTCCCTGCAAGACAAATGG - Intergenic
1170616133 20:17953243-17953265 GTGCTGCCCTAGATGACACAGGG + Intronic
1171373753 20:24678031-24678053 CTGCTGCCCTGGAATGCCAAAGG + Intergenic
1171447310 20:25214041-25214063 CAGCTGCCATGGGGAACAAACGG - Intronic
1171456335 20:25274825-25274847 CTGCCTCCCTGGAGGACTTAAGG + Intronic
1171953310 20:31440539-31440561 CTGCTGACCTAAATGACAAAGGG + Exonic
1172888817 20:38249317-38249339 CTGTTGCCCAGGGGGGCAAAGGG + Intronic
1174879820 20:54267060-54267082 CTGCTGCGCTTGAAGACACAAGG + Intergenic
1175443175 20:59004693-59004715 CTGCTGCCTTGGCTGGCAAATGG + Intronic
1175491043 20:59381452-59381474 GGGCTGCCTTGGAGGTCAAATGG + Intergenic
1178698058 21:34810973-34810995 CTGCTGCTCTGCAGGAGGAAGGG - Intronic
1179460297 21:41530069-41530091 CTGCTGAGCTGTAGGACCAAAGG - Intronic
1181879112 22:25963495-25963517 CTGGTGTCCTTGAGGACACATGG - Intronic
1182094837 22:27619130-27619152 CTGCTGGTCTGCAGGACACAAGG + Intergenic
1182369581 22:29801566-29801588 CTGCTGCCCTGAAGGCCCCATGG - Intronic
1182967001 22:34531660-34531682 TTGCTTCCCTGGAGGACATTTGG - Intergenic
1183248092 22:36709483-36709505 CTGCTGCCCTGGAGGTGATATGG - Intergenic
1183498270 22:38162911-38162933 CTGAGGCTCTGGAGGACACACGG + Intronic
1184480821 22:44745875-44745897 CTGCTGCCCTGGTTGACAGCAGG - Intronic
1184560464 22:45260118-45260140 CTGCTGCCCTGGTGGGCATCGGG + Intergenic
1184675011 22:46036783-46036805 CAGAGGCCCTGGAGGGCAAAGGG + Intergenic
1184991895 22:48176012-48176034 CTACCTCCCTGGAGGACAATGGG + Intergenic
1185173680 22:49307363-49307385 CTGGTGTCCTGGTGGACACAGGG - Intergenic
949876488 3:8629279-8629301 CCACTGCCCTGCACGACAAATGG + Intronic
950297946 3:11848116-11848138 CTGCTGCCCTGCAGGAGCTAGGG + Intergenic
950440086 3:13005426-13005448 CTGCTGCCTTGGAGGACTGCTGG - Intronic
950545433 3:13635347-13635369 CAGGCACCCTGGAGGACAAAAGG - Intronic
953152013 3:40333375-40333397 CTACTGCCAGGGAGGAAAAAAGG + Intergenic
953253127 3:41264406-41264428 CTTCTGCCACTGAGGACAAAGGG - Intronic
953407412 3:42666304-42666326 CTGCTGTCCTGGGGGAGAGAAGG + Intergenic
954201269 3:49024745-49024767 CTGGTGCTGTGCAGGACAAAGGG - Exonic
954597436 3:51838490-51838512 CTACTACCCAGGAGCACAAAGGG - Intergenic
954615891 3:51968390-51968412 CATCTGGCCTGGTGGACAAAGGG + Intronic
955623370 3:60890333-60890355 ATGCTGCCCTGGAAGATCAACGG - Intronic
955786253 3:62542572-62542594 CTGCTGCCCAGAGGCACAAATGG + Intronic
957595002 3:82252339-82252361 CTTCTCCCCTGCAGGAGAAATGG + Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
966007750 3:175037196-175037218 ATGTTGTCCTGGAGGACAAGTGG - Intronic
968428267 4:537298-537320 CTGCTCCCCTGCAGCGCAAATGG + Intronic
968579918 4:1385068-1385090 CTGATGCCCAGGAGGAGGAATGG + Intronic
969088835 4:4677181-4677203 TTGCTCCCCTGGAGAAGAAATGG - Intergenic
969702268 4:8774071-8774093 TTGCTTCCCTGGAGGCCGAAGGG - Intergenic
969838411 4:9862174-9862196 CTTCTGCCAGGGAGAACAAAGGG + Intronic
971481075 4:27115643-27115665 ATGTGGCCCTGAAGGACAAAAGG - Intergenic
973194905 4:47428570-47428592 CTACTGCCCAGGAGGGCATATGG - Intergenic
973662874 4:53125999-53126021 CTTCTCCCATGAAGGACAAAGGG + Intronic
973788388 4:54356450-54356472 CAGCTGCCTTGGATGTCAAATGG - Intergenic
977358835 4:95980054-95980076 CTGCTGCCCTGGGGGCCACCAGG + Intergenic
979868789 4:125790363-125790385 CTGCTGCCCCAGAAGATAAAGGG + Intergenic
980032488 4:127846236-127846258 CTACTGGCCTGGAGGTTAAATGG + Intergenic
984186117 4:176545865-176545887 CTACAGCCCTTGAGGACAACTGG - Intergenic
988771938 5:34440966-34440988 CTGCTCAGGTGGAGGACAAAGGG + Intergenic
988846368 5:35131948-35131970 CAGAAACCCTGGAGGACAAATGG + Intronic
990488310 5:56280285-56280307 CTACTGCTCTGGAGCACAGAAGG + Intergenic
991512510 5:67395317-67395339 CTGAATACCTGGAGGACAAATGG - Intergenic
992878451 5:81081269-81081291 CTGGAGCCCTGGAGAACAAAAGG + Intronic
992965664 5:81997272-81997294 CTGCTGCACTGGAGGAGCCAAGG - Intronic
994945496 5:106382881-106382903 TTCCTGCCTTGGAGGACATAGGG + Intergenic
995488074 5:112659091-112659113 CTGCTGCACTGGAGGAGCCAAGG - Intergenic
997286081 5:132679614-132679636 CTTCTTTCCAGGAGGACAAATGG - Intronic
998394047 5:141806802-141806824 CTGCAGCCCTAGAGGGGAAATGG + Intergenic
998788871 5:145744236-145744258 CTGCTGGTCTGCAGGAGAAAAGG - Intronic
999099032 5:149006953-149006975 CTGCAGCCATGGTGGACAGAGGG + Exonic
1001198933 5:169698490-169698512 CAGCAGCCCTTGATGACAAAGGG - Intronic
1001998121 5:176178384-176178406 CAGCTGCCATGGAGGATGAAAGG + Intergenic
1002451282 5:179320196-179320218 CTGCTGCCCAGGAGCACAGCAGG - Intronic
1002549861 5:179979671-179979693 CTGGTGGCTTGGAGGACCAAGGG - Intronic
1002886107 6:1295700-1295722 CTGCCTCCCTGGAGGAGAAATGG - Intergenic
1004705089 6:18117257-18117279 CTGGTGCCCTGGAGGTAACATGG + Intergenic
1005142948 6:22654931-22654953 CTGTTGCCCAGGAGCCCAAACGG + Intergenic
1005999658 6:30955383-30955405 ATGCAGCACTGGAGGTCAAAGGG + Intergenic
1006170190 6:32087875-32087897 CTGCTGGCCTCGAGGGCCAAGGG + Intronic
1006514391 6:34538033-34538055 CTGCTCCCCTGGAGGACAGAGGG - Exonic
1007101626 6:39251650-39251672 CTGTTGCCCTGGGGGAGAAGGGG + Intergenic
1012134171 6:95535332-95535354 CTGCTGGGGTGGAGGAGAAAAGG - Intergenic
1014041548 6:116832630-116832652 ATGCTGCCCTGAAAAACAAAAGG - Intergenic
1014253500 6:119139028-119139050 CTGCTACCGTGCATGACAAAGGG - Intronic
1015248995 6:131106979-131107001 CCCCTGCCCTGAATGACAAAAGG + Intergenic
1017089477 6:150745899-150745921 CGGCCACCCTGGAGAACAAAAGG + Intronic
1017646112 6:156541256-156541278 CTTCTGCCCAAGAGGCCAAAGGG + Intergenic
1019017620 6:168891313-168891335 CTGCTGCCATCCAGGACAAGAGG + Intergenic
1022134869 7:27437711-27437733 CTTCTGCCCTGGAGAACAGAAGG + Intergenic
1023184683 7:37521007-37521029 CTTCTTCCCTGGAGGCTAAATGG - Intergenic
1024325631 7:48107272-48107294 CTGATGCCCAGAAGGACACAGGG - Intronic
1025035858 7:55592160-55592182 CTACTGCCCTTGAGGACAATGGG - Intergenic
1027554578 7:79647816-79647838 CTGCTGCGCTGGAGGAGTCAAGG + Intergenic
1033416693 7:141167836-141167858 CTGCTTCCCTGGGGCACAACGGG - Intronic
1034082464 7:148292214-148292236 TTCTTGCCCAGGAGGACAAAGGG + Intronic
1034637199 7:152576821-152576843 CTCCTGCCCTTAAGGAAAAAGGG + Intergenic
1035421741 7:158735053-158735075 GTGCTGCCATGGAGGGCACATGG - Intronic
1036218918 8:6904074-6904096 CTGTTGCTGTGGAGGTCAAATGG + Intergenic
1036501586 8:9319386-9319408 CTGCTGCCCTGGAGCTGAAGAGG - Intergenic
1038466217 8:27766293-27766315 CTGGAGCCCTGAAGGACAAAGGG + Intronic
1038614653 8:29081279-29081301 CTGCTGCCCTGTTGGGGAAATGG - Intronic
1038672727 8:29595446-29595468 CTGCTGCCCTCCAGCCCAAAAGG - Intergenic
1042745749 8:72103819-72103841 TTGCTTCCCTGGTGGACAAATGG + Intronic
1043142095 8:76603201-76603223 TTGCTGCCTTGGAGGAGAACAGG + Intergenic
1045499889 8:102737161-102737183 TTACTGTTCTGGAGGACAAAAGG + Intergenic
1048268023 8:133004743-133004765 CTGGTACCCTGGAGGACCATAGG + Intronic
1048321149 8:133401128-133401150 CAGTTTCCCTGGAGGAAAAATGG - Intergenic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1049543452 8:143218823-143218845 CTGCTGGGCTGGATGAGAAAGGG - Intergenic
1049889199 9:52488-52510 CCACTGCCCTGGAGGACCAGGGG - Intergenic
1049925930 9:407042-407064 CTGCTGCCCTGGATGCCGAAGGG + Exonic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1053174725 9:35914530-35914552 CTCCTGCCCTTGGGGACAATAGG - Intergenic
1053730684 9:41053773-41053795 CCACTGCCCTGGAGGACCAGGGG - Intergenic
1054697817 9:68378303-68378325 CCACTGCCCTGGAGGACCAGGGG + Exonic
1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG + Intronic
1057845312 9:98518153-98518175 CAACTGCTCTGGAGGACAAGGGG - Intronic
1057897072 9:98917743-98917765 CTGCTGCCCTGGAGGCCCTCTGG - Intergenic
1058028434 9:100168425-100168447 TATCTGCCCTGGAGGCCAAATGG - Intronic
1058892774 9:109375074-109375096 TGGCAGCCCTGCAGGACAAAAGG + Intergenic
1059092044 9:111369967-111369989 CTTCTCCCATGGAGGGCAAATGG + Intronic
1059539815 9:115118794-115118816 CTACTGCCCTGCAGGACACTGGG - Intergenic
1060309419 9:122445927-122445949 CTGTTCCCTTGGAGCACAAAGGG - Intergenic
1061925567 9:133804565-133804587 CTGAAGCCCTGGAGGAGGAATGG - Intronic
1062059854 9:134489356-134489378 CTGATACCATAGAGGACAAAAGG + Intergenic
1062067251 9:134535385-134535407 CTGCTGGCCTTGACGACGAAGGG - Intergenic
1062450977 9:136615675-136615697 CTGCCGGCCTGCAGGACCAAAGG - Intergenic
1062602528 9:137324254-137324276 AGGCCACCCTGGAGGACAAAAGG - Intronic
1062694442 9:137866281-137866303 CTGCTTCCCTGGGGGACTAGAGG - Intronic
1189259546 X:39668752-39668774 CTGCTGCCCTGGCAGACTCACGG - Intergenic
1190225900 X:48544812-48544834 CTGGTGCCCTGGAGGCCTCAGGG - Intronic
1190402699 X:50054619-50054641 CTGCTTACCTGGAGTAGAAATGG - Intronic
1192363995 X:70455772-70455794 CTGCAGCCCTAGGGGACAAAGGG - Intronic
1192676237 X:73199604-73199626 CTGCTGCCCTGAAGGGCACCAGG + Intergenic
1197377895 X:125705041-125705063 CTGCTGCCCTGGAGGGGCCAAGG + Intergenic
1197479625 X:126966275-126966297 CTGCTGACCTGGTGGAGAAAAGG - Intergenic
1200057915 X:153471041-153471063 CTGGTTCCCAGGAGGACCAAGGG + Intronic
1201143430 Y:11047350-11047372 CTGCTGCCCAGGAACACAGAGGG + Intergenic
1201730043 Y:17193010-17193032 CTGCTGCCCTGGAGTAAAGGCGG + Intergenic
1201764112 Y:17563653-17563675 AGGCTGCCCTGGAGGAAAAGCGG - Intergenic
1201837441 Y:18342337-18342359 AGGCTGCCCTGGAGGAAAAGCGG + Intergenic