ID: 1049416986

View in Genome Browser
Species Human (GRCh38)
Location 8:142499778-142499800
Sequence AGCGGGGGCGTGCAAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049416974_1049416986 12 Left 1049416974 8:142499743-142499765 CCCTGAAGGTGAGCAGAGATGGA 0: 1
1: 0
2: 2
3: 33
4: 260
Right 1049416986 8:142499778-142499800 AGCGGGGGCGTGCAAGGAGAGGG No data
1049416975_1049416986 11 Left 1049416975 8:142499744-142499766 CCTGAAGGTGAGCAGAGATGGAA 0: 1
1: 0
2: 1
3: 41
4: 292
Right 1049416986 8:142499778-142499800 AGCGGGGGCGTGCAAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049416986 Original CRISPR AGCGGGGGCGTGCAAGGAGA GGG Intronic
No off target data available for this crispr