ID: 1049420071

View in Genome Browser
Species Human (GRCh38)
Location 8:142512534-142512556
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049420063_1049420071 4 Left 1049420063 8:142512507-142512529 CCTGCTATGGTGTGTGCCCCATC 0: 1
1: 0
2: 0
3: 11
4: 77
Right 1049420071 8:142512534-142512556 CCTTCTCCCAGCCCGGTGTCAGG No data
1049420061_1049420071 20 Left 1049420061 8:142512491-142512513 CCTGGGCAGGAGAGAACCTGCTA 0: 1
1: 0
2: 2
3: 17
4: 241
Right 1049420071 8:142512534-142512556 CCTTCTCCCAGCCCGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr