ID: 1049420080

View in Genome Browser
Species Human (GRCh38)
Location 8:142512571-142512593
Sequence GTGTTGGAGTCTGGAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049420066_1049420080 23 Left 1049420066 8:142512525-142512547 CCATCTGCCCCTTCTCCCAGCCC 0: 1
1: 2
2: 30
3: 233
4: 1674
Right 1049420080 8:142512571-142512593 GTGTTGGAGTCTGGAAACACAGG No data
1049420065_1049420080 24 Left 1049420065 8:142512524-142512546 CCCATCTGCCCCTTCTCCCAGCC 0: 1
1: 0
2: 10
3: 135
4: 904
Right 1049420080 8:142512571-142512593 GTGTTGGAGTCTGGAAACACAGG No data
1049420074_1049420080 3 Left 1049420074 8:142512545-142512567 CCCGGTGTCAGGCCTGCAGCAGG 0: 1
1: 0
2: 3
3: 41
4: 365
Right 1049420080 8:142512571-142512593 GTGTTGGAGTCTGGAAACACAGG No data
1049420076_1049420080 2 Left 1049420076 8:142512546-142512568 CCGGTGTCAGGCCTGCAGCAGGT 0: 1
1: 1
2: 5
3: 27
4: 236
Right 1049420080 8:142512571-142512593 GTGTTGGAGTCTGGAAACACAGG No data
1049420064_1049420080 25 Left 1049420064 8:142512523-142512545 CCCCATCTGCCCCTTCTCCCAGC 0: 1
1: 1
2: 31
3: 378
4: 1482
Right 1049420080 8:142512571-142512593 GTGTTGGAGTCTGGAAACACAGG No data
1049420072_1049420080 8 Left 1049420072 8:142512540-142512562 CCCAGCCCGGTGTCAGGCCTGCA 0: 1
1: 0
2: 0
3: 11
4: 218
Right 1049420080 8:142512571-142512593 GTGTTGGAGTCTGGAAACACAGG No data
1049420078_1049420080 -9 Left 1049420078 8:142512557-142512579 CCTGCAGCAGGTCAGTGTTGGAG 0: 1
1: 0
2: 1
3: 27
4: 220
Right 1049420080 8:142512571-142512593 GTGTTGGAGTCTGGAAACACAGG No data
1049420073_1049420080 7 Left 1049420073 8:142512541-142512563 CCAGCCCGGTGTCAGGCCTGCAG 0: 1
1: 1
2: 1
3: 18
4: 245
Right 1049420080 8:142512571-142512593 GTGTTGGAGTCTGGAAACACAGG No data
1049420069_1049420080 15 Left 1049420069 8:142512533-142512555 CCCTTCTCCCAGCCCGGTGTCAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1049420080 8:142512571-142512593 GTGTTGGAGTCTGGAAACACAGG No data
1049420068_1049420080 16 Left 1049420068 8:142512532-142512554 CCCCTTCTCCCAGCCCGGTGTCA 0: 1
1: 0
2: 1
3: 34
4: 385
Right 1049420080 8:142512571-142512593 GTGTTGGAGTCTGGAAACACAGG No data
1049420070_1049420080 14 Left 1049420070 8:142512534-142512556 CCTTCTCCCAGCCCGGTGTCAGG 0: 1
1: 0
2: 0
3: 21
4: 280
Right 1049420080 8:142512571-142512593 GTGTTGGAGTCTGGAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049420080 Original CRISPR GTGTTGGAGTCTGGAAACAC AGG Intronic
No off target data available for this crispr