ID: 1049421450

View in Genome Browser
Species Human (GRCh38)
Location 8:142518399-142518421
Sequence GGCCCCTCCGAGGCCTCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 254}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049421440_1049421450 18 Left 1049421440 8:142518358-142518380 CCCAGTCACCTCCGCATTTGCCA 0: 1
1: 0
2: 3
3: 5
4: 93
Right 1049421450 8:142518399-142518421 GGCCCCTCCGAGGCCTCCACAGG 0: 1
1: 0
2: 1
3: 32
4: 254
1049421444_1049421450 7 Left 1049421444 8:142518369-142518391 CCGCATTTGCCACGGAACCAGCC 0: 1
1: 0
2: 1
3: 8
4: 74
Right 1049421450 8:142518399-142518421 GGCCCCTCCGAGGCCTCCACAGG 0: 1
1: 0
2: 1
3: 32
4: 254
1049421445_1049421450 -2 Left 1049421445 8:142518378-142518400 CCACGGAACCAGCCATGCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1049421450 8:142518399-142518421 GGCCCCTCCGAGGCCTCCACAGG 0: 1
1: 0
2: 1
3: 32
4: 254
1049421443_1049421450 10 Left 1049421443 8:142518366-142518388 CCTCCGCATTTGCCACGGAACCA 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1049421450 8:142518399-142518421 GGCCCCTCCGAGGCCTCCACAGG 0: 1
1: 0
2: 1
3: 32
4: 254
1049421439_1049421450 27 Left 1049421439 8:142518349-142518371 CCTCACGTTCCCAGTCACCTCCG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1049421450 8:142518399-142518421 GGCCCCTCCGAGGCCTCCACAGG 0: 1
1: 0
2: 1
3: 32
4: 254
1049421447_1049421450 -10 Left 1049421447 8:142518386-142518408 CCAGCCATGCTGTGGCCCCTCCG 0: 1
1: 0
2: 2
3: 32
4: 256
Right 1049421450 8:142518399-142518421 GGCCCCTCCGAGGCCTCCACAGG 0: 1
1: 0
2: 1
3: 32
4: 254
1049421441_1049421450 17 Left 1049421441 8:142518359-142518381 CCAGTCACCTCCGCATTTGCCAC 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1049421450 8:142518399-142518421 GGCCCCTCCGAGGCCTCCACAGG 0: 1
1: 0
2: 1
3: 32
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049421450 Original CRISPR GGCCCCTCCGAGGCCTCCAC AGG Intronic
900126617 1:1071674-1071696 GGCATCTCTGAGGACTCCACCGG - Exonic
900131272 1:1088287-1088309 GGACCCTCCCACGCCTCCCCAGG + Intronic
900158531 1:1212885-1212907 GGCCCCACCGGTGCCTCCTCTGG - Intronic
900345557 1:2208714-2208736 GGCCCCTCCCAAGCCTGCCCAGG - Intronic
900401996 1:2476426-2476448 GGGCCCTCCGAAGCCCCCACAGG - Exonic
900512837 1:3068535-3068557 GGCTCCTCCGAAGCCCCCTCCGG - Intergenic
900956275 1:5888045-5888067 GGCCCCTCCCTGGGCCCCACGGG - Intronic
901240519 1:7690391-7690413 AGACACTCTGAGGCCTCCACTGG - Intronic
902049898 1:13554950-13554972 GGCCCCGCCGAGGCCTGACCGGG - Intergenic
902330166 1:15727396-15727418 GGCCTCTCCGGGGCATCCCCGGG - Exonic
903459004 1:23507957-23507979 GGCTGCTCTGAGGTCTCCACTGG - Exonic
903968794 1:27105990-27106012 GGCCCCTCGCAGGCCCCCATAGG + Exonic
904404078 1:30274856-30274878 GGGCCTTCCCAGGCCTCCAAGGG + Intergenic
904565545 1:31426119-31426141 GACCCCTCCAAGGCCTCTCCAGG - Intronic
904828950 1:33294643-33294665 GCCCTCTCCGAGGCCTGCACTGG + Intronic
905629540 1:39511040-39511062 GGCCCCACCCAGGCCTCCCTGGG + Intronic
905668220 1:39775150-39775172 GGCCCCACCCAGGCCTCCCTGGG - Intronic
907513619 1:54980126-54980148 TCCCTCTCCGGGGCCTCCACTGG + Intergenic
912386538 1:109273703-109273725 AGCCCCTCGGAGGCCTCACCTGG + Intronic
912697777 1:111854531-111854553 TGCCCCTCTGACCCCTCCACTGG - Intronic
915141139 1:153769351-153769373 GGTCCTTCTGAGGCCTGCACTGG + Intronic
916543857 1:165783792-165783814 GGACCCTCCGAGCCATGCACGGG + Intronic
917207914 1:172597074-172597096 GGACCCTCCGAGCCATGCACGGG + Intronic
917788881 1:178487018-178487040 GGGCCCTGCGAGGCGCCCACGGG + Intergenic
919603165 1:199647666-199647688 GGACCCTCCGAGCCATGCACGGG - Intergenic
920442570 1:205990690-205990712 GGTCCTTCGGAAGCCTCCACTGG - Intronic
920651487 1:207840554-207840576 GGCCCCACAGAGGCCACCAGGGG + Intergenic
920835323 1:209505624-209505646 AGCCCAGCTGAGGCCTCCACTGG - Intergenic
922505154 1:226121926-226121948 CGCCCCTCCGCGGGCTCCCCAGG - Intergenic
1062812921 10:478982-479004 GGCTCCACAGAGGCCTCCACAGG + Intronic
1063580443 10:7301598-7301620 GGCATCTCCGCTGCCTCCACAGG + Intronic
1063648439 10:7909084-7909106 GGCCCCTGGCAGGCCTCCACGGG - Intronic
1064203316 10:13302203-13302225 GGCAGCTCCCAGGCTTCCACTGG + Intronic
1066452404 10:35542611-35542633 GGCCCTGCCAAGGCCTCCCCAGG - Intronic
1067054864 10:43044610-43044632 AGCCCCTCAGAGCCCTGCACAGG + Intergenic
1067766504 10:49091292-49091314 GGCCACTCTGGGGCCTCCCCAGG + Intronic
1069556977 10:69404911-69404933 GCCCCCTCCGAGGCTACCAGTGG - Exonic
1070305038 10:75234799-75234821 GGCCCCTCCCAGGCCGGCCCGGG + Intronic
1071774310 10:88768065-88768087 GTCCCTTCCTGGGCCTCCACTGG - Intronic
1074188375 10:111115739-111115761 GACCCCTCCCAGGCCACCTCAGG + Intergenic
1074401039 10:113141369-113141391 GGAACCTTTGAGGCCTCCACAGG + Intronic
1075674412 10:124286438-124286460 GGCTCCTGCGAGGCCTCGAGCGG - Intergenic
1075693845 10:124419139-124419161 GGCCCCTCGGTCGCCTCCTCTGG + Intergenic
1076133652 10:128030111-128030133 CACCCCTCCGAGGCCTTCCCAGG + Intronic
1076207454 10:128614420-128614442 GGCCCACCCGAGGCCTCACCGGG - Intergenic
1076273365 10:129175718-129175740 GGTCCCTCCAAAGCCTCCAGGGG + Intergenic
1077006937 11:362847-362869 GGCCCCTAGCAGGCCTCCTCTGG - Intergenic
1077080932 11:724444-724466 GGCCCATCCCAGGCCACCTCAGG - Intronic
1077217984 11:1403035-1403057 GGACCCCCCGGGGCCACCACGGG + Intronic
1077394811 11:2315638-2315660 GACCCTGCGGAGGCCTCCACAGG + Intronic
1078032221 11:7764444-7764466 GGACCCTCCGAGGCAGGCACGGG - Intergenic
1081492528 11:43579406-43579428 GGCCCCTCCCCGCCCCCCACGGG - Intronic
1082273719 11:50199548-50199570 GGACCCTCCGAGCCATGCACGGG + Intergenic
1083306399 11:61764236-61764258 GGCCCCTCCCTGGCCTCAGCCGG - Intronic
1083721272 11:64604753-64604775 GGCCTCTCCCAGACTTCCACAGG + Intergenic
1083945672 11:65921273-65921295 AGCCCCACCGTGCCCTCCACAGG - Intronic
1084547388 11:69821229-69821251 GGCTCCTCCCAGTCCTCCAGAGG - Intergenic
1085229122 11:74949431-74949453 GCCGCCTCCCAGGCCTCCCCAGG - Intronic
1086409124 11:86526223-86526245 GGACCCTCCGAGCCATGCACGGG - Intronic
1089074630 11:115728377-115728399 GGCCCCTCCAAGAACACCACTGG - Intergenic
1091383652 12:78316-78338 CGCCCCTCCTCGGCCTCCACGGG + Intronic
1091665429 12:2415380-2415402 GGGCGCTGCGCGGCCTCCACGGG - Intronic
1092259040 12:6942575-6942597 GCCCAGACCGAGGCCTCCACTGG - Intergenic
1092718457 12:11416508-11416530 GGACCCTCCGAGCCATGCACGGG - Intronic
1092898939 12:13040530-13040552 AGGGCCTCGGAGGCCTCCACTGG - Intergenic
1093013987 12:14138079-14138101 GGCACATCCGAGGCCTTCCCAGG - Intergenic
1095103749 12:38207548-38207570 GGACCCTCCGAGCCATGCACAGG - Intergenic
1095913950 12:47457585-47457607 GGACCCTCCGAGCCATGCACGGG + Intergenic
1096800300 12:54106331-54106353 GCCCGCTCCGAGGACTCCCCAGG - Intergenic
1097193731 12:57232653-57232675 GGCCTCTCCGGGCCCTCCCCAGG + Intronic
1099245827 12:80192285-80192307 GGCCCCTCCTAGAACTGCACTGG - Intergenic
1100919249 12:99463640-99463662 GGACCCTCCGAGCCATGCACAGG - Intronic
1101430381 12:104621876-104621898 GGCCTCTCCCAGGCCTCCTTTGG - Intronic
1101640869 12:106584951-106584973 GGCCCCGCTGAGGTCTCTACTGG + Intronic
1102548760 12:113675481-113675503 GTCCCCTCTGCCGCCTCCACTGG + Intergenic
1104916623 12:132268884-132268906 GGCCCCTCCGCGACCCTCACCGG - Intronic
1104981378 12:132574396-132574418 GGGCCCCCCGAGGCCGCCCCGGG - Exonic
1106172159 13:27297488-27297510 GACCCCTGTGAGGCCCCCACTGG + Intergenic
1106400796 13:29428431-29428453 GGCCGCTCCCAGCCCTCCCCTGG - Intronic
1107608486 13:42087188-42087210 GGCCCTTCTGAGGCTTCTACAGG - Intronic
1116540983 14:46101186-46101208 GGACCCTCCGAGCCATGCACGGG + Intergenic
1119853253 14:77881205-77881227 GGCCCCTGCCAGGCCTCCATAGG - Intronic
1120846373 14:89129493-89129515 GGAGCCTGAGAGGCCTCCACAGG - Intronic
1122523474 14:102363178-102363200 AGCCCCTCCTCGGCCTCCCCCGG + Intronic
1122918243 14:104868606-104868628 GGCACCTTCCTGGCCTCCACAGG - Intronic
1125756685 15:42069852-42069874 GGCCCCTCAGAGGCCTGCCCTGG - Intronic
1126542514 15:49839005-49839027 GGACCCTCCGAGCCATGCACGGG + Intergenic
1127867579 15:63044196-63044218 GGCCACTCCGGGGTCACCACAGG + Intronic
1129326495 15:74802691-74802713 GGCCCCTCAGTGGGCTCCCCAGG - Exonic
1130540457 15:84817670-84817692 GGCCCAGCCCAGGCCTCCAGGGG - Intronic
1132374679 15:101321163-101321185 GGCCTCTCCCAGGCCGCCAGCGG + Intronic
1132681587 16:1144650-1144672 GTCCCCTCTGAGGCCGCCACTGG + Intergenic
1132743791 16:1428534-1428556 GGCCCTTCTGGGTCCTCCACTGG + Intergenic
1132885615 16:2180831-2180853 GGCCCCACCTCGCCCTCCACGGG + Exonic
1133026695 16:2991732-2991754 AGCAGCTCAGAGGCCTCCACAGG - Intergenic
1135958039 16:26972618-26972640 GGCCCCACCGAGACCTCCATGGG + Intergenic
1136220162 16:28823397-28823419 GGCTCCTCCCGGGCCTCCAGCGG + Exonic
1137579669 16:49626361-49626383 GTCCCCTCCTAGGTCTCCCCAGG + Intronic
1141957881 16:87384386-87384408 CGCCCCTCCAAGCCCTCCCCGGG - Intronic
1142113769 16:88345832-88345854 GGCCCCACCGAGGCTGCCAGAGG + Intergenic
1142131452 16:88433327-88433349 GGCCCCGCCCAGGGCTCCCCAGG + Exonic
1142376032 16:89707578-89707600 GGCCTCTCTGAGGCCTACACAGG + Exonic
1142376859 16:89711048-89711070 GGCCTCTCCGTGGCATCCACAGG + Intronic
1142550102 17:732913-732935 AGCCCCTCCGCGTCCTCCCCTGG + Intronic
1142809073 17:2386872-2386894 GGCCACTCAGAGGCCCCCAGTGG - Exonic
1143164488 17:4891095-4891117 GGTCCCTCCTGGGGCTCCACCGG - Exonic
1147363234 17:39944336-39944358 AGCCCCACAAAGGCCTCCACGGG - Exonic
1148554584 17:48570639-48570661 GGAACCTCCGAGGCCGACACCGG - Intronic
1149664735 17:58357779-58357801 GGTCCCTCCGAGCCCACCCCTGG - Exonic
1150623397 17:66824705-66824727 GGCCCCTCTGTGGCCCCCCCGGG - Intergenic
1150648130 17:66992600-66992622 GGCCCCTTCGAGGCATCCCATGG + Intronic
1152087142 17:78227255-78227277 GGCGCCTCCGAGGCCACAAGGGG - Intergenic
1152424677 17:80212469-80212491 GGCCCATTCGAGGCCTGCTCAGG - Intronic
1152739305 17:82012050-82012072 GGCCCTTCCGAGCCCTCAGCTGG + Intronic
1153719365 18:7885926-7885948 GGCCCCTCTGAGTGCTTCACAGG + Intronic
1153892719 18:9533049-9533071 GGCCCCTGTGAGGCCCCCACAGG - Intronic
1154355597 18:13621494-13621516 GACCCCTCCCAGGTCTCCCCTGG + Intronic
1160731055 19:642001-642023 TGCCACTCCCAGGCCTCAACTGG + Intronic
1160805257 19:989750-989772 TGCCCCTCACAGGTCTCCACCGG + Exonic
1161316345 19:3619323-3619345 GGCCCCTCCTCGGCTCCCACTGG - Intronic
1161620103 19:5293164-5293186 AGGCCCCGCGAGGCCTCCACAGG + Intronic
1161940371 19:7399200-7399222 GGCAGCTGCGAGGCTTCCACTGG - Intronic
1162080890 19:8217042-8217064 GGCCAATCTGAGGCCTCCAGAGG + Intronic
1162942529 19:14021685-14021707 GCCCCCTCTGAGGCCTCTAGGGG + Intergenic
1165428210 19:35757073-35757095 GGCCCCTCGGAGGGCTGCCCAGG + Intronic
1165950767 19:39472943-39472965 GCCCCTCCCCAGGCCTCCACAGG - Intronic
1166412414 19:42564873-42564895 GTCCACACCGAGGCCACCACAGG + Intergenic
1167251038 19:48398514-48398536 CGCCCCGCCGAGGCCGCCGCCGG - Exonic
1167295205 19:48645633-48645655 GGTCCCTCGGAGGCCTCCTGGGG - Exonic
1167355284 19:48999804-48999826 GGCTACTGCGAGGGCTCCACAGG - Intronic
1168111218 19:54192189-54192211 GGCCACTGCCAGGCCTCGACCGG + Exonic
926128207 2:10284744-10284766 GGCCCTACGGAGGCATCCACTGG - Intergenic
926171649 2:10556475-10556497 TGCCCATCCCAGGCCTCCATGGG + Intergenic
927217351 2:20675502-20675524 GGCCCCTGAGCGGCCTCCCCTGG - Intergenic
928331298 2:30359944-30359966 GGCCCCTCAGAGGGCTCCTGTGG + Intergenic
932220558 2:69995760-69995782 TGCCCCTCCCAGGCCTCTCCAGG - Intergenic
932340793 2:70961516-70961538 GGCCCCTCCCAGGTGTCCTCAGG - Intronic
933809748 2:86025929-86025951 TGCACCTCCTAGGCCTACACTGG - Exonic
935272119 2:101443811-101443833 GCCCCCTACTAGGTCTCCACTGG - Intronic
937239422 2:120450699-120450721 GGCACCTCGGAGGCCTCTACTGG - Intergenic
937252425 2:120533370-120533392 GGCCCCTCCCCAGCCCCCACAGG - Intergenic
937905569 2:127051221-127051243 GCCACCTCCGAGGCCTCTGCTGG + Exonic
938156854 2:128949079-128949101 GGACCCTCCGAGCCATGCACGGG + Intergenic
938294793 2:130171524-130171546 CTCACCTCCGAGTCCTCCACAGG + Intronic
938994771 2:136666449-136666471 TGCCCCTCTGTGGCCTCCATGGG + Intergenic
942775110 2:179572011-179572033 GGCCACTCCCAGGCCCCCACAGG - Intronic
948193150 2:236075608-236075630 TGCCCCTCAGTGGCCTCCAGGGG + Intronic
948654534 2:239468636-239468658 GGCCCCTCTGCAGCCTCCACTGG - Intergenic
1171175576 20:23049175-23049197 GGCCCCTGCGCGGCTTCCAGTGG - Exonic
1172767641 20:37359207-37359229 GGCCCCACCTAGGGCCCCACAGG - Intronic
1174178243 20:48658283-48658305 AGCCCCACCGTGGCCCCCACAGG + Intronic
1175523849 20:59620031-59620053 TGCCCCTCCGAGGCCCTCCCTGG + Intronic
1176281502 20:64316402-64316424 CGGCCCTCCTCGGCCTCCACGGG - Intergenic
1176375665 21:6085867-6085889 GGCCCCAGCGAGGCTTCCTCTGG - Intergenic
1178313083 21:31545732-31545754 GGCTCCTCTGTGGCCCCCACTGG + Intronic
1179747809 21:43452377-43452399 GGCCCCAGCGAGGCTTCCTCTGG + Intergenic
1179784154 21:43720127-43720149 GGCCTCTCCTACCCCTCCACGGG - Intronic
1179809877 21:43864316-43864338 GGCACCTGCGCGGCCTCCGCAGG + Intergenic
1179833438 21:44012491-44012513 GGCTCCTCAGAGGCGTCCATGGG - Exonic
1180054915 21:45352738-45352760 AGCCCCTCCTCGGCCTCCTCCGG + Intergenic
1180061231 21:45386067-45386089 CGGCCCTCAGAGCCCTCCACAGG - Intergenic
1180061269 21:45386213-45386235 CGGCCCTCAGAGCCCTCCACAGG - Intergenic
1181119153 22:20653903-20653925 GGCCCCATGCAGGCCTCCACAGG - Intergenic
1183078907 22:35443836-35443858 GCCCCCTCCGAGGCCTGCACTGG - Intergenic
1183421758 22:37715828-37715850 GCCCCTCCCGAGGCCTCCTCGGG - Exonic
1183484432 22:38081717-38081739 AGCCCCTCCCTGGCCCCCACAGG + Intronic
1183524791 22:38316869-38316891 GGGCCCTCCGAGGCCCCGGCCGG - Intronic
1183664807 22:39241199-39241221 GGCACCTCAGAGGCCTCGGCAGG + Intronic
1184675236 22:46038069-46038091 GGCCCCTCAGAGACCTGAACAGG + Intergenic
1184804164 22:46781696-46781718 GGCCCCTCCCTGGCCTGCCCCGG + Intronic
1184840998 22:47052379-47052401 GGTCCCTCCCAGGCATCCCCAGG - Intronic
1185069483 22:48648239-48648261 GGCCCCTGCCAGGCCTCCCAGGG + Intronic
1185077856 22:48692894-48692916 AGCCCCTCCCAGGCCACCTCAGG + Intronic
949462753 3:4311243-4311265 GCTCCACCCGAGGCCTCCACAGG + Intronic
950630550 3:14279101-14279123 CGCCCCTCAGAGTCCTCCCCAGG - Intergenic
952451818 3:33440218-33440240 GGCCGCTCCGAGGACCACACGGG + Exonic
952964879 3:38614898-38614920 TGCCCATCTGTGGCCTCCACAGG + Intronic
953524722 3:43679295-43679317 GGACCCTCCGAGCCATGCACGGG - Intronic
953649287 3:44785860-44785882 GGCACCCTAGAGGCCTCCACAGG - Intronic
954459275 3:50617257-50617279 GCCCCCTCTGCGGCCTCCTCCGG + Intronic
954795782 3:53160910-53160932 GGCCCCTCCCAGGCCCCAGCGGG + Intronic
955059813 3:55485109-55485131 GGGCCCTCGGAGGCCCCCAGAGG - Intronic
959749743 3:109819528-109819550 GACCCCTCCCACGCCCCCACAGG + Intergenic
961168095 3:124777317-124777339 AGCCCCTCCGTGGCTCCCACTGG - Intronic
963714416 3:148786427-148786449 GGACCCTCCGAGCCATGCACGGG + Intergenic
968073723 3:195804344-195804366 GGCCCCTCTGGTGACTCCACAGG + Intronic
968082116 3:195853846-195853868 GGCAGCCCCGAGGCCTCCTCGGG + Intergenic
968603347 4:1520654-1520676 AGCCCCTCCGAGGCCGCCCCGGG + Intergenic
968603366 4:1520695-1520717 AGCCCCTCCGAGGCCGCCCCGGG + Intergenic
968603405 4:1520777-1520799 AGCCCCTCCGAGGCCGCCCCGGG + Intergenic
968603464 4:1520900-1520922 AGCCCCTCCGAGGCCGCCCCGGG + Intergenic
968603483 4:1520941-1520963 AGCCCCTCCGAGGCCGCCCCGGG + Intergenic
968603521 4:1521023-1521045 AGCCCCTCCGAGGCCGCCCCGGG + Intergenic
968603540 4:1521064-1521086 AGCCCCTCCGAGGCCGCCCCGGG + Intergenic
968603559 4:1521105-1521127 AGCCCCTCCGAGGCCGCCCCGGG + Intergenic
968603578 4:1521146-1521168 AGCCCCTCCGAGGCCGCCCCGGG + Intergenic
968603597 4:1521187-1521209 AGCCCCTCCGAGGCCGCCCCGGG + Intergenic
968616338 4:1579284-1579306 GGCCCAGCCGAGGCCACCAGGGG - Intergenic
969330533 4:6471623-6471645 GGCCCCTCCCTGTCCTCCAGAGG - Intronic
969582035 4:8071297-8071319 AGCCCCTCCCATGCCCCCACAGG + Intronic
969650643 4:8465843-8465865 GGCCACACTGAGGCCTCCTCTGG - Intronic
972511322 4:39770747-39770769 GCCCCCTCCCAGGCCTCCAGGGG + Intronic
973982263 4:56316295-56316317 GGCCCACCCTGGGCCTCCACCGG + Exonic
984787532 4:183582809-183582831 TGCCCCACTGATGCCTCCACTGG + Intergenic
984876883 4:184376713-184376735 GTCCCCTCCAAAGCCTCCAGGGG - Intergenic
985122546 4:186658833-186658855 GGCCCCTGCCACGCCTCCACCGG + Intronic
985353822 4:189096262-189096284 GGACCCGCCGTGGGCTCCACTGG + Intergenic
985800480 5:2002508-2002530 GGCCCCTCCAAGCCCTGCCCTGG - Intergenic
985887033 5:2687804-2687826 GGACCCTGGGAGACCTCCACAGG - Intergenic
985947959 5:3201299-3201321 GCTCCCTCCAAGGCCTCCAGGGG + Intergenic
986279939 5:6314549-6314571 GCCCCCTCCAAAGCCTCCAGAGG - Intergenic
987076296 5:14385140-14385162 AGCCCCTCAGAGGCCTCCGGTGG + Intronic
990799352 5:59582941-59582963 GGCCCCTCTGAGGACACCAGAGG - Intronic
991674139 5:69075311-69075333 AGCCCCACGAAGGCCTCCACGGG - Intergenic
997897907 5:137736191-137736213 GGCCCCTCTGTGGCCTGCAGTGG + Intergenic
999209164 5:149872691-149872713 GGCTCCTCCAAGGCCTTCCCCGG - Intronic
1000037414 5:157459961-157459983 CGCTCCTCCGATGCCTGCACCGG - Intronic
1001814862 5:174660056-174660078 GGCCCCTCTGCAGCCTTCACAGG - Intergenic
1002026245 5:176397790-176397812 GGCCCCTGCCAGGCAGCCACAGG + Intronic
1002429303 5:179193876-179193898 GGCCCCTCCCAGGCTGCCCCTGG - Intronic
1002495693 5:179610061-179610083 GGGCGCTCTGAGGCCTCCTCCGG - Intergenic
1002597669 5:180334797-180334819 GTCTCCTCCCAGGCCTCCAAGGG - Intronic
1002662703 5:180802627-180802649 GGCGCCCGCGAGGCCTCCCCCGG + Intronic
1003367071 6:5484977-5484999 GGCTCCTCCGGGGCCTCTTCAGG - Intronic
1006136773 6:31900610-31900632 ACCCCCTCCCAGGCCTCCAGGGG + Exonic
1006496373 6:34426141-34426163 GGCACCGCCGAGGCCACCCCAGG - Intergenic
1006561528 6:34917134-34917156 GGCCCCATGGAGGCCTACACAGG - Intronic
1007165345 6:39824988-39825010 GGCCCCTCTGAAGCCACCCCAGG - Intronic
1007172142 6:39871416-39871438 AGCCCCTTCGAGCCCCCCACTGG - Intronic
1014266458 6:119283587-119283609 AGCCCCTCCGAGGCCTTCCCTGG - Intronic
1014277213 6:119400322-119400344 GGACCCTCCGAGCCATGCACGGG - Intergenic
1018469776 6:164085194-164085216 GGCCCCTCCGCTGGCTCCTCCGG + Intergenic
1018565977 6:165153558-165153580 GGCCACTCCTAGGCCTGCAATGG - Intergenic
1018722206 6:166581542-166581564 GGCCTCTCGGTGGCCTCAACAGG - Intronic
1018867131 6:167754910-167754932 GGCCCCACAGCGGCCTCCCCAGG - Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019512384 7:1424176-1424198 GGCCCTCCCCAGGCCTGCACTGG - Intergenic
1019989634 7:4682513-4682535 GGCTCCTCCGGGGGCTCCTCCGG + Exonic
1020085525 7:5308146-5308168 GGCACCTACGAGCCCACCACGGG - Exonic
1020192165 7:6008858-6008880 CGCCACTCCGGGGCCTCCAGGGG + Intronic
1022472180 7:30688753-30688775 GGCCCCTCAGAGGTTTCCAGTGG - Intronic
1023847319 7:44129751-44129773 AGCCCCTCCCTGACCTCCACGGG - Intergenic
1025208782 7:57009090-57009112 GGCACCTACGAGCCCACCACAGG + Intergenic
1026903772 7:74051253-74051275 GGGGCCTGCGGGGCCTCCACTGG - Intronic
1026923737 7:74174550-74174572 CGCCGCTCCTAGGCCTCCGCGGG - Intronic
1026928758 7:74211153-74211175 GGACCCTCTGAGGCCCCCAGGGG - Intronic
1032322248 7:130896077-130896099 GGGCCGTCCAGGGCCTCCACAGG - Intergenic
1034399438 7:150852424-150852446 GGCCCCTCCTAGGCCAGCTCAGG + Intronic
1034539278 7:151745818-151745840 GGCCCCACCGAGCCCTCCATGGG - Intronic
1034921154 7:155083526-155083548 GGTGCCCCCAAGGCCTCCACAGG - Intronic
1035437160 7:158867735-158867757 GGCCTCTCCTGGGCCTCCCCGGG + Intronic
1035596835 8:865125-865147 GGCCCCTTCCAGATCTCCACAGG + Intergenic
1035747695 8:1973947-1973969 GGCCCCGCCGCTGCCTCCCCGGG - Intronic
1036749422 8:11434550-11434572 GGCCCTGCCGAGGACTCCACAGG + Intronic
1040445100 8:47485202-47485224 GGACCCTCCGAGCCTTGCACGGG - Intronic
1043177590 8:77042196-77042218 GGACCCTCCGAGCCATGCACGGG - Intergenic
1047704913 8:127488627-127488649 GGCCCCTGCCAGGCCTCTGCTGG + Intergenic
1048328226 8:133454697-133454719 GGCCTCTCCAAGGCCTACGCTGG + Intergenic
1049421450 8:142518399-142518421 GGCCCCTCCGAGGCCTCCACAGG + Intronic
1049607300 8:143535689-143535711 GGGCCTTCCCAGGCCACCACAGG + Intronic
1049717043 8:144097993-144098015 GGCCCCTCCTAGCAGTCCACAGG + Intergenic
1049748622 8:144273393-144273415 GTCCCCCACGAGGCCTCCACTGG - Intronic
1053521021 9:38779728-38779750 GGACCCTCCGAGCCATGCACGGG - Intergenic
1053688132 9:40562232-40562254 GACCGCTCTGAGGCCTTCACTGG + Intergenic
1054299369 9:63363143-63363165 GACCGCTCTGAGGCCTTCACTGG + Intergenic
1055985741 9:82055721-82055743 GGCCCATCCGAGCTGTCCACAGG - Intergenic
1057228516 9:93304929-93304951 TGGCCCACGGAGGCCTCCACGGG - Intronic
1060618802 9:125044272-125044294 GGCCCATCCGTGGCCTCCCATGG + Intronic
1061290885 9:129649720-129649742 GCGCCCTCCCCGGCCTCCACTGG - Intergenic
1062000531 9:134213682-134213704 GGCCCCTCCTGGACCTCCCCTGG - Intergenic
1203775048 EBV:68259-68281 GGGCCATACGAGGCCTTCACTGG + Intergenic
1185750924 X:2609224-2609246 CGCCCCACCCCGGCCTCCACTGG - Intergenic
1185826152 X:3252873-3252895 AGCCCCTCAGAGGCACCCACTGG + Intergenic
1186504903 X:10083391-10083413 GGCCACTCCTTGGCCTCCAGGGG - Intronic
1186982755 X:14974787-14974809 GGACCCTCCGAGCCATGCACAGG + Intergenic
1187788175 X:22917352-22917374 TGCTCCTCCGGGGCTTCCACTGG - Intergenic
1189322311 X:40094439-40094461 GGCCGCTCCGAGCGCACCACGGG + Intronic
1189398856 X:40647011-40647033 GCCACCTCCCAGGCGTCCACGGG + Exonic
1190327986 X:49218470-49218492 GGCCCCTCCGAGCCATCAACAGG - Exonic
1191184231 X:57592526-57592548 GGCCCCGCCGCGGCCTTCGCGGG + Exonic
1191213162 X:57909933-57909955 GGCCCCGCCGCGGCCTTCGCGGG - Exonic
1193329851 X:80223715-80223737 GGCACTTCCATGGCCTCCACAGG + Intergenic
1196478782 X:116121543-116121565 GGACCCTCCGAGCCATGCACGGG - Intergenic
1196925548 X:120630145-120630167 GGCCCTTCCGACGCCTGCGCGGG - Exonic
1199996639 X:153030384-153030406 GGCTCCTTCGAGGCCTGCAGGGG - Intergenic
1200141291 X:153904273-153904295 GGCCCCTCCCAGGCCCACGCAGG - Intronic
1200212825 X:154354470-154354492 GGCCTCTCCGGGGCCTGCAGTGG + Exonic
1201252854 Y:12076973-12076995 GGCCCCTCAGAGGCACCCAGTGG - Intergenic