ID: 1049423206

View in Genome Browser
Species Human (GRCh38)
Location 8:142525901-142525923
Sequence TCCTGGCCTCCTCTGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 376}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049423206_1049423223 21 Left 1049423206 8:142525901-142525923 CCCCCCAGCAGAGGAGGCCAGGA 0: 1
1: 0
2: 4
3: 47
4: 376
Right 1049423223 8:142525945-142525967 GCTCAGGGCCAGTGGCTTCCCGG No data
1049423206_1049423218 6 Left 1049423206 8:142525901-142525923 CCCCCCAGCAGAGGAGGCCAGGA 0: 1
1: 0
2: 4
3: 47
4: 376
Right 1049423218 8:142525930-142525952 GGGAGACCCCAGGATGCTCAGGG No data
1049423206_1049423216 -4 Left 1049423206 8:142525901-142525923 CCCCCCAGCAGAGGAGGCCAGGA 0: 1
1: 0
2: 4
3: 47
4: 376
Right 1049423216 8:142525920-142525942 AGGAGACAGGGGGAGACCCCAGG No data
1049423206_1049423225 23 Left 1049423206 8:142525901-142525923 CCCCCCAGCAGAGGAGGCCAGGA 0: 1
1: 0
2: 4
3: 47
4: 376
Right 1049423225 8:142525947-142525969 TCAGGGCCAGTGGCTTCCCGGGG No data
1049423206_1049423221 13 Left 1049423206 8:142525901-142525923 CCCCCCAGCAGAGGAGGCCAGGA 0: 1
1: 0
2: 4
3: 47
4: 376
Right 1049423221 8:142525937-142525959 CCCAGGATGCTCAGGGCCAGTGG No data
1049423206_1049423217 5 Left 1049423206 8:142525901-142525923 CCCCCCAGCAGAGGAGGCCAGGA 0: 1
1: 0
2: 4
3: 47
4: 376
Right 1049423217 8:142525929-142525951 GGGGAGACCCCAGGATGCTCAGG No data
1049423206_1049423224 22 Left 1049423206 8:142525901-142525923 CCCCCCAGCAGAGGAGGCCAGGA 0: 1
1: 0
2: 4
3: 47
4: 376
Right 1049423224 8:142525946-142525968 CTCAGGGCCAGTGGCTTCCCGGG No data
1049423206_1049423226 24 Left 1049423206 8:142525901-142525923 CCCCCCAGCAGAGGAGGCCAGGA 0: 1
1: 0
2: 4
3: 47
4: 376
Right 1049423226 8:142525948-142525970 CAGGGCCAGTGGCTTCCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049423206 Original CRISPR TCCTGGCCTCCTCTGCTGGG GGG (reversed) Intronic
900157565 1:1209317-1209339 TCCAGGCCTCCTGTGCCTGGCGG - Intergenic
900228705 1:1545094-1545116 TCCCGGCTGCCTCTGCTGTGGGG - Intronic
900474599 1:2870214-2870236 TCCTGCCCTCACTTGCTGGGAGG + Intergenic
900587027 1:3437537-3437559 TCCTGGCGTCCCTGGCTGGGAGG - Exonic
900763653 1:4489122-4489144 GCTTGGCCTCCTGTGCTGGAGGG - Intergenic
900935555 1:5764232-5764254 TCCTGCCCTCCTCTTCTTGGGGG - Intergenic
901012617 1:6210080-6210102 TGCTGCCCTCCTTAGCTGGGAGG - Intronic
901045376 1:6393014-6393036 TCCTGGCCGCATCTCCAGGGCGG - Intronic
901228636 1:7629781-7629803 TCCTGCCCTCCTCTCCAGGCTGG + Intronic
901702850 1:11054707-11054729 GCCCGGCCTGCCCTGCTGGGCGG - Exonic
901810984 1:11766649-11766671 TCCTTGCTTCCTCGGATGGGAGG + Intronic
902454729 1:16524515-16524537 TCCTGGCCTCCTTCTCTGTGTGG + Intergenic
902497720 1:16885838-16885860 TCCTGGCCTCCTTCTCTGTGTGG - Intronic
902576713 1:17382575-17382597 TTCAGCCCTCCTCTCCTGGGAGG + Intronic
902774300 1:18664751-18664773 TCCTAGCCTCCCCTTCTCGGGGG - Intronic
902988623 1:20170972-20170994 TCCTGGGGTCCTGGGCTGGGAGG + Intronic
902988859 1:20172095-20172117 TCCTGGGGTCCTGGGCTGGGAGG - Intronic
903302633 1:22390241-22390263 TGCAGGTCTCCTCTGCTGGATGG + Intergenic
903732023 1:25503669-25503691 CCCTGTCCTCCTCTGCACGGAGG + Intergenic
904385097 1:30135947-30135969 TCCCAGCCTCCTCTGCAGGTAGG - Intergenic
905372639 1:37492403-37492425 TGTTGGTCTCCTTTGCTGGGAGG - Intergenic
907250274 1:53133523-53133545 TCCAGGACTCCTCTGCAGAGAGG - Intronic
907422782 1:54358368-54358390 TCCTGGCCTCCTGAGCTGGGTGG - Intronic
908331132 1:63072368-63072390 TCCTGGCTTCCTGGACTGGGTGG - Intergenic
911734743 1:101324692-101324714 TCCTGGCCTCCTTAGGTGGATGG + Intergenic
912649485 1:111425204-111425226 TCCTGGCCTCTTCTCCATGGTGG - Intronic
912966814 1:114242999-114243021 GCCTGGCCGCCCCTTCTGGGAGG + Intergenic
913710308 1:121476348-121476370 TCCTGGCATCTTATGCTTGGTGG + Intergenic
915120423 1:153627040-153627062 CCCTGTGCTTCTCTGCTGGGAGG - Intronic
915561330 1:156689966-156689988 CCCCAGCCTCCTATGCTGGGTGG + Intergenic
915876591 1:159617084-159617106 GCCTGTCAACCTCTGCTGGGAGG - Intergenic
915979226 1:160409779-160409801 TCCTGGGATCCTGGGCTGGGAGG + Intronic
916023448 1:160814285-160814307 TCCTGGCCTCCTCCTCTGAGGGG - Intronic
916070859 1:161168975-161168997 TCTTTGCTTCCTCTGCAGGGCGG + Exonic
917534454 1:175864282-175864304 TTCTGGCCTCCCCTCCTGGAGGG - Intergenic
918786435 1:188769554-188769576 TTCTGGCCACCCCTGTTGGGAGG - Intergenic
919021196 1:192108200-192108222 CACTGTCCTCCTCTGCTGGATGG - Intergenic
919824610 1:201494458-201494480 TTCTGGCCTCCTTTGCAGGCTGG + Intronic
920238959 1:204529587-204529609 TACTGCCCTCCACTACTGGGGGG + Intronic
920575296 1:207054868-207054890 TCCTGGACTCTGCTGCTTGGTGG + Intronic
921044109 1:211460920-211460942 GCCCGGCCGCCCCTGCTGGGAGG + Intergenic
921266832 1:213427958-213427980 TCATGGCCTTCTGTGCTGTGGGG + Intergenic
921394425 1:214653262-214653284 GCCTGCCCTCATCTGCTGTGTGG - Intronic
922155430 1:223037136-223037158 TCCTGGCCTTCTCAGATGGTGGG + Intergenic
922182234 1:223244376-223244398 TCCTGGCCTCCTCTTGTGTCTGG - Intronic
922666614 1:227474609-227474631 GTCTGTCATCCTCTGCTGGGAGG - Intergenic
922800085 1:228361163-228361185 TCCTGGCCTTTTCTGCAGGGTGG + Intronic
922821483 1:228488128-228488150 TCTTGGTGTCCCCTGCTGGGCGG + Intronic
923526280 1:234775334-234775356 TCCTGGAGTCATCTGCTGGAAGG + Intergenic
923731981 1:236560477-236560499 TTCTCCCCTCCTCTGCTGTGCGG - Intronic
924095619 1:240547822-240547844 GCCTGACTTCCTCTTCTGGGTGG - Intronic
924451275 1:244181339-244181361 TCCAGGTCTCCTCCGCAGGGAGG - Intergenic
924900035 1:248388004-248388026 TCCTGTCCTCATCAGCTGGCGGG + Exonic
1062981371 10:1725572-1725594 TCCTGGGCGTCTCTTCTGGGTGG - Intronic
1065001030 10:21337693-21337715 TCCTGTGCTCCCCTGCTGGTTGG - Intergenic
1066294309 10:34041000-34041022 TCCCGGCCTTCCCTGCTGTGTGG - Intergenic
1067749162 10:48958516-48958538 TCTTGGCCTCCATTGCTGGTAGG - Intronic
1069321227 10:67173916-67173938 TCATGGCTGCCTCTGCTGGAAGG + Intronic
1069814981 10:71188115-71188137 TCCTCCTCCCCTCTGCTGGGAGG - Intergenic
1072493958 10:95936090-95936112 CCCTGGCATACTCTGCTGGGTGG - Intronic
1072921764 10:99582856-99582878 TCGTGGCCTCTTCTACTGTGAGG - Intergenic
1073480132 10:103781231-103781253 TCCCAGCCTCCCTTGCTGGGAGG + Intronic
1073676280 10:105650474-105650496 TACTGGTCTCCCCTGCTGTGAGG - Intergenic
1074754712 10:116615757-116615779 GCCTGGTCTCTTCTGCAGGGTGG - Intergenic
1074827268 10:117223589-117223611 TCCTGGCCTTCTGTGGTGGGTGG + Intergenic
1075066202 10:119290663-119290685 TCCTGTCCTCTTCTGCTTGGTGG + Intronic
1075418494 10:122283170-122283192 TCCGGCCCTGCTCTGCTCGGAGG - Intronic
1075453221 10:122567786-122567808 TTCCAGCCTCCTCTCCTGGGAGG - Intronic
1075736576 10:124668025-124668047 GCCTGGGCTCCCCTGCTAGGAGG - Intronic
1075955405 10:126519078-126519100 TCCTGGTTCCCTCTGCTGGAAGG - Intronic
1076378994 10:130012262-130012284 TGCTGGCCTCCCTTGCTGGCTGG - Intergenic
1076556053 10:131322199-131322221 GCCTGGGCTCCCCTGCTGGGAGG - Intergenic
1076877790 10:133225070-133225092 TCCTGGCTCCGTCTGCTGGGAGG - Exonic
1077420004 11:2445584-2445606 TCCTTCCCTCCTCTGCTCCGGGG - Intronic
1078354907 11:10626159-10626181 TCCCGGCCCCCGCTGCTGCGAGG - Exonic
1079092116 11:17488373-17488395 TCCCTGCCTCCTCTCCTGAGAGG - Intergenic
1080410851 11:32023599-32023621 TCCCGTCCTCCTCTGCTTGGAGG - Intronic
1080589894 11:33713439-33713461 TCCTGTCCTCCTCCTCTGAGGGG + Intronic
1083212051 11:61194216-61194238 TCCTGCCCTCCTGCCCTGGGCGG - Intergenic
1083227546 11:61294532-61294554 GCCTGGCCTCCCCTGCCGCGCGG - Intronic
1083660406 11:64249414-64249436 TCCTGACCTCCTGTGGTTGGGGG + Intergenic
1083691493 11:64411558-64411580 TCCTGCTGTCCTCTGTTGGGAGG + Intergenic
1084454812 11:69262337-69262359 TCCTGGGCTCCTCTCTAGGGAGG + Intergenic
1084586450 11:70065491-70065513 CACTGGGATCCTCTGCTGGGAGG - Intergenic
1084681991 11:70671775-70671797 TCCTGGCATCCCTTGCTTGGGGG - Intronic
1085392310 11:76188801-76188823 TCCTTCCCTCCTCTGCACGGCGG - Intronic
1085737688 11:79053656-79053678 GCCTGGCTTCCTCTGATGGTGGG - Intronic
1086100752 11:83097054-83097076 TCCTGGCCTCCTTTGCAGTTAGG + Intergenic
1086455217 11:86954480-86954502 TTCTGGCCGCCACTGCTCGGTGG - Intronic
1088413834 11:109567518-109567540 TGCTGGCCTTCTCTGCAGGGAGG - Intergenic
1088440574 11:109866336-109866358 TCTTGTCCTCCTCTGCTGACTGG - Intergenic
1088593672 11:111423907-111423929 TCTCGGCCTCCTCTTCTGGCAGG - Intronic
1088809883 11:113385142-113385164 TCCTTGCCCCTTCTGGTGGGTGG + Intergenic
1089296075 11:117469135-117469157 CCATGGCCTCCTCTGGTGGAAGG + Intronic
1090549939 11:127808678-127808700 TCCTGGCATCCTGGGCTGGGTGG + Intergenic
1090803782 11:130190159-130190181 TGCCCGCCTCCTCTTCTGGGTGG + Intronic
1091168260 11:133499445-133499467 CCCTGGCCTCCCCTCCTGTGGGG + Intronic
1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG + Intronic
1093710729 12:22327403-22327425 TCCTTGCCCCCTCTGATGTGTGG + Intronic
1094474797 12:30832966-30832988 CCCTCCCCTCCCCTGCTGGGAGG + Intergenic
1095049371 12:37543037-37543059 TCCTCGCCTCTGCTCCTGGGTGG + Intergenic
1095570088 12:43674982-43675004 TCCTGGCCTCCACAGATGGCAGG - Intergenic
1096064040 12:48725000-48725022 GCCCGGCCGCCCCTGCTGGGAGG + Intergenic
1096079911 12:48826449-48826471 TCTTGGCCAGCTGTGCTGGGTGG - Exonic
1096229389 12:49888844-49888866 TCCCGTCCTCCTCTGTGGGGTGG - Intronic
1096243975 12:49974228-49974250 GCCTGGTCTCCTCAGCTGGAGGG - Intronic
1096865421 12:54559928-54559950 ACCTGTCCTCATCTCCTGGGTGG + Intronic
1097285809 12:57876381-57876403 CCCTGGCCTCCTATGCTGCTGGG - Intergenic
1097288439 12:57895135-57895157 TCATAGCCTCCTGTCCTGGGAGG + Intergenic
1101472600 12:105012913-105012935 TTCTGTCAACCTCTGCTGGGAGG + Intronic
1102215835 12:111160852-111160874 TCCTGGCCTGAACAGCTGGGTGG + Intronic
1104960909 12:132488426-132488448 TCCTGGCCTTCTGTCCAGGGAGG + Intergenic
1104996400 12:132660373-132660395 TCCTGGCTTGCTTTGCTGTGTGG - Intronic
1105023648 12:132834603-132834625 GCCTGCCCTCCTCTCCTGGCTGG + Intronic
1108246103 13:48515920-48515942 TCCGGGCCTCCGCTGCTCGATGG - Intronic
1108698757 13:52925987-52926009 TCCTGCCCGCCTCGGCTTGGCGG + Intergenic
1109549345 13:63872957-63872979 TGCTCACCTCCTCTGCTGTGTGG + Intergenic
1110300652 13:73922888-73922910 CCCAGGCCTCCTCTGTAGGGTGG + Intronic
1113770432 13:112904698-112904720 TCCTTGCCTCGTCTGCTCTGTGG + Intronic
1114298877 14:21356048-21356070 TCCTAGCCTGCTATGCAGGGAGG + Intronic
1114410557 14:22496588-22496610 TGTTGACCTCCTGTGCTGGGTGG + Intergenic
1115612496 14:35062089-35062111 TTCTGCCTTCCTTTGCTGGGAGG + Intronic
1118323428 14:64766563-64766585 ACGTAGCCTGCTCTGCTGGGAGG + Intronic
1119548465 14:75490888-75490910 TCCTAGCCTCCTTTGCAGTGAGG - Intergenic
1119691641 14:76677567-76677589 TGCTGGCATCCACTTCTGGGGGG - Intergenic
1121325173 14:93015650-93015672 TCCTGGCATCCCCTGCTTGGGGG - Intronic
1121329292 14:93040003-93040025 TCCTGCCAGCCCCTGCTGGGAGG + Intronic
1121534997 14:94685169-94685191 TGCTGCCCTCCTCTGGTGGCTGG + Intergenic
1122781939 14:104147414-104147436 CCCCTTCCTCCTCTGCTGGGAGG - Intronic
1123758542 15:23415597-23415619 TCCTTTCCTCCTCTGCTTGATGG - Intergenic
1124200896 15:27677799-27677821 TCCTGCCCTCTGCTGTTGGGTGG + Intergenic
1124340789 15:28887926-28887948 TCCTGGGCTCCTGGGATGGGAGG + Intronic
1125762100 15:42103833-42103855 TCCTTTCATCCTATGCTGGGTGG - Intergenic
1127661389 15:61103191-61103213 GGCTGCCCTCCTCTCCTGGGCGG + Intronic
1128450691 15:67804444-67804466 TCCTGCCCTCCTCAGCTGGGAGG - Intronic
1129562805 15:76589609-76589631 TCCTTGCTTTCTCAGCTGGGAGG - Intronic
1129858294 15:78840814-78840836 TCCTGCCCTGCCCTGCTGGGTGG + Intronic
1129880194 15:79001365-79001387 CCCTGCCCACCTGTGCTGGGTGG + Intronic
1132826508 16:1908039-1908061 TCCTGGCCTGCTGGGATGGGTGG - Intergenic
1132857811 16:2054814-2054836 TCCTGCCATCCTGTGGTGGGAGG + Intronic
1132949778 16:2554661-2554683 CCCGGGCCTCCTCTGCTCTGCGG + Intronic
1132964570 16:2645506-2645528 CCCGGGCCTCCTCTGCTCTGCGG - Intergenic
1133999011 16:10768149-10768171 TCCTGGCTTCCTCGGCTATGGGG - Exonic
1134215142 16:12311453-12311475 TCCTGGCTTCCTCTGCTGGCTGG + Intronic
1136031205 16:27504345-27504367 TGCTGGGCTCCACTGCTGGAAGG + Intronic
1136668683 16:31836832-31836854 GCCCGGCCGCCCCTGCTGGGAGG + Intergenic
1139365430 16:66429520-66429542 CCCTGGCCACCTGTGCTGTGTGG + Intronic
1139473949 16:67193177-67193199 TCCTGGCGGTCCCTGCTGGGGGG + Intronic
1139505975 16:67398262-67398284 CCTTGGCCTCCTGTGGTGGGCGG + Exonic
1139961738 16:70721916-70721938 TCCTGTGCTCCTGTGCTGTGGGG - Intronic
1140904082 16:79395619-79395641 TCCTGGCTTCTGCTGGTGGGTGG - Intergenic
1141280187 16:82624336-82624358 TCCTGGGCTGTTCTGCTGGCAGG - Intergenic
1141903372 16:87007034-87007056 TCCTGACCCCCACTTCTGGGTGG - Intergenic
1142344754 16:89546832-89546854 TCGAGGCCTCCTCTGTGGGGTGG + Intronic
1142545664 17:700853-700875 TTCTGGCTACCTCTGATGGGAGG + Intronic
1142566586 17:844158-844180 TCCTGCCCTCCTTAGCTGGAAGG + Intronic
1142566626 17:844308-844330 TCCTGCCCTCCTTAGCTGGAAGG + Intronic
1142566638 17:844357-844379 TCCTGCCCTCCTTAGCTGGAAGG + Intronic
1142566650 17:844406-844428 TCCTGCCCTCCTTAGCTGGAAGG + Intronic
1143742560 17:8965326-8965348 TCCGGGTAACCTCTGCTGGGCGG - Intronic
1143782789 17:9238153-9238175 GCCTGCCCTCCTATGCTGGCTGG - Intronic
1143931879 17:10437811-10437833 TCTAGGCCTCCTCTGATGGTGGG + Intergenic
1144380842 17:14696428-14696450 TCTTGGTCTCCTCTGATGTGAGG - Intergenic
1144825370 17:18102794-18102816 TCCTGCCCTCCTTTGCAGGGTGG + Intronic
1144853816 17:18257489-18257511 TGCTGGCCTGCCCTGCAGGGTGG - Intronic
1145979300 17:29002431-29002453 TCCTGGCCTCCTCAGCAGGGTGG - Intronic
1146565127 17:33906337-33906359 TCTTGACATCCTCAGCTGGGTGG + Intronic
1147877500 17:43632111-43632133 TCCTTTCCTCCTCTCCTGAGGGG - Intergenic
1148225286 17:45894819-45894841 TCCCTGCCTCCCCTGCTCGGGGG + Intronic
1148644283 17:49210443-49210465 CCTTGGCTTCCTCTGCTGGGTGG + Exonic
1151422869 17:74009881-74009903 TCCTGGACACCAGTGCTGGGGGG - Intergenic
1151558467 17:74859011-74859033 CCCTGGCTTCCCCTCCTGGGTGG + Intronic
1152204605 17:78967837-78967859 CCAGGGCCTCCTCTGCTGAGAGG + Intergenic
1152405565 17:80096116-80096138 GCAGGGCCTCGTCTGCTGGGGGG + Intronic
1152579701 17:81160466-81160488 TGCCGGCTTCCTCTGCGGGGGGG + Intronic
1152616277 17:81339398-81339420 TCCTGGAGCTCTCTGCTGGGAGG + Intergenic
1153985021 18:10343921-10343943 GCCTGGCCTCCCCTGCTGGAGGG + Intergenic
1154010665 18:10571564-10571586 TCCTGGCCCTCTCTTCTGGCTGG - Intergenic
1154483150 18:14856106-14856128 TCCTGGTCTCCCCGTCTGGGAGG - Intergenic
1154483509 18:14857505-14857527 TCCTGGTCTCCCCGTCTGGGAGG - Intergenic
1154483571 18:14857729-14857751 TCCTGGTCTCCCCGTCTGGGAGG - Intergenic
1154483930 18:14859125-14859147 TCCTGGTCTCCCCGTCTGGGAGG - Intergenic
1154483992 18:14859349-14859371 TCCTGGTCTCCCCGTCTGGGAGG - Intergenic
1156308916 18:35904937-35904959 GCCTGGCCTCCTCTTCCAGGTGG + Intergenic
1157476337 18:48025921-48025943 AGCTGGCCCCCTCTGCTGAGGGG + Intergenic
1157563145 18:48662571-48662593 GCCTGGCCCCTTCTGCTTGGAGG + Intronic
1160900381 19:1424894-1424916 TCCAGGCCTCCCCGGCTAGGTGG - Intronic
1161242374 19:3229473-3229495 TCCTGGCCTCCACTCCTGCGGGG - Intronic
1161441199 19:4292626-4292648 TTTTGGCCTCGGCTGCTGGGTGG + Exonic
1162104475 19:8362061-8362083 TCCTGTCCACTGCTGCTGGGAGG + Intronic
1162344525 19:10111591-10111613 CGCTGGCCTGCTCTGCTGGCTGG + Exonic
1162471129 19:10872315-10872337 GCGTGGCCGCCTCTGCAGGGAGG + Intronic
1163190407 19:15673081-15673103 TCTTCTCCTCTTCTGCTGGGAGG - Exonic
1163222941 19:15934834-15934856 TCCTCTCCCCCTCTGCTAGGAGG + Exonic
1163420992 19:17213554-17213576 AACTGGCCACCTCTGCTGGATGG - Intronic
1163546321 19:17943253-17943275 TCTTGGCTTTCTCGGCTGGGCGG - Exonic
1163722683 19:18905754-18905776 GGGTGTCCTCCTCTGCTGGGCGG - Intronic
1164601276 19:29565252-29565274 TCCTGGCCTCCTGTGGCGGGTGG + Intergenic
1164733350 19:30522132-30522154 TCCTTGGCTCCTCTGCTCTGTGG + Intronic
1164788433 19:30956330-30956352 GCCTGGCCTCCTTGGCTGTGTGG + Intergenic
1165099051 19:33427538-33427560 TCCTGGCATCCTCCGATTGGAGG - Intronic
1166752681 19:45172182-45172204 TCCTGGGCACCTGTGCTGTGGGG + Intronic
1166752948 19:45173374-45173396 TCCTGGGCACCTGTGCTGTGGGG + Intronic
1167530902 19:50015768-50015790 GCCTGGACTCCCCTGCTTGGAGG - Intronic
924993910 2:340122-340144 GCCTGGCCTCCTCTAGGGGGTGG - Intergenic
925685684 2:6470595-6470617 TCCTGGCCTGTGCTGCTGAGAGG - Intergenic
926417960 2:12669025-12669047 GCCTGGCCACATTTGCTGGGAGG - Intergenic
926855288 2:17249714-17249736 ACCTGGCTTCCTCTGCAGTGAGG - Intergenic
927364096 2:22274021-22274043 TCCTAGCCTCCTTTGCAGTGAGG - Intergenic
927464478 2:23326716-23326738 TACTGGACTTCTCTGCTGGTTGG - Intergenic
927929073 2:27032787-27032809 TCCCGGCCTCTTCGCCTGGGCGG + Intergenic
928403164 2:30993842-30993864 CCCTTGCCTCCTCTGCTGGAGGG - Intronic
931319906 2:61166062-61166084 TACTGACACCCTCTGCTGGGAGG + Intergenic
932615050 2:73226448-73226470 TCCTGCCCGCCTCTGCTTGCTGG - Exonic
934054609 2:88241285-88241307 TCCTGGGCTCCTCCTCTGGGCGG - Intergenic
934123026 2:88858157-88858179 TCAGGGCCTGCTCTGCAGGGAGG - Intergenic
934939592 2:98490726-98490748 TTCTGGCCTCATCTACTCGGAGG - Intronic
936091628 2:109505154-109505176 TCCTGGGCTCTTCTGTTGGTGGG - Intergenic
937253100 2:120536447-120536469 TCATGGCCTCCACTGCTGCTTGG + Intergenic
937370666 2:121295272-121295294 ACCTGGCCTACTCTTCTGGGCGG - Intergenic
940898463 2:159104048-159104070 TCCTTGCTTCCACTGCTGAGTGG + Intronic
940986413 2:160056388-160056410 CCCTGACCTCCTCTGCTGTGAGG + Intronic
941357851 2:164514778-164514800 TGCTTGCCTCCTCAGTTGGGAGG + Intronic
941603033 2:167563714-167563736 GCCCGGCCGCCGCTGCTGGGAGG - Intergenic
941603084 2:167563837-167563859 GCCCGGCCGCCCCTGCTGGGAGG - Intergenic
941723523 2:168837124-168837146 TCATGGCCTAATCTGGTGGGAGG + Intronic
942110985 2:172682546-172682568 TCCTGTCCTCCTCTGCATGCAGG + Intergenic
944499749 2:200347279-200347301 TCCTAGCCTCCTTTGCAGTGAGG + Intronic
946648714 2:221868460-221868482 TCCTGGTCCCCGCTGCTGGCAGG - Intergenic
947100956 2:226620822-226620844 TGCTGGGCTCCTCTCTTGGGGGG + Intergenic
947445815 2:230161780-230161802 GCCTGGAGTCCTGTGCTGGGAGG + Intergenic
947532604 2:230922283-230922305 TCCTGGCTCCCTCTGCTTGGGGG + Intronic
947536574 2:230943481-230943503 TCCGGGCATCCCCAGCTGGGGGG + Intronic
947633888 2:231670530-231670552 TCCTGGTCCCCTCTGCCGTGAGG + Intergenic
947740892 2:232484393-232484415 CCCTGGACCTCTCTGCTGGGTGG - Intronic
947927191 2:233932241-233932263 TCCTGCCCTTCTCTGATGGATGG + Intronic
948654259 2:239466813-239466835 CCCTGGCCTACTCTGGGGGGCGG + Intergenic
948762338 2:240199737-240199759 TCCTGCCCGGGTCTGCTGGGGGG - Intergenic
1170717848 20:18847434-18847456 TGCTGCTCTCATCTGCTGGGTGG + Intergenic
1171110963 20:22482214-22482236 TCCTGGCCTCCTGTGGGGGCTGG - Intergenic
1171211982 20:23324244-23324266 TCCTGGCTTCCCCGTCTGGGTGG - Intergenic
1171459512 20:25290947-25290969 CCCTGGGCCCCTCTGCTGGCAGG + Intronic
1171459542 20:25291040-25291062 CCCTGGGCCCCTCTGCTGGCAGG + Intronic
1171961274 20:31496806-31496828 CTCTTGCCTCCTCTGCTGGGTGG - Intergenic
1172225431 20:33302282-33302304 TCCTGCACCCCACTGCTGGGAGG - Intronic
1172338109 20:34133104-34133126 GCCCGGCCGCCCCTGCTGGGAGG + Intergenic
1173615347 20:44399909-44399931 GCCTGTCCTCCACTGCTGGCTGG - Intronic
1174065381 20:47860808-47860830 GCCCGGCCTGCCCTGCTGGGTGG + Intergenic
1174961219 20:55159240-55159262 ACCTGGCCTTCGCTGCTGAGTGG + Intergenic
1175503513 20:59466592-59466614 TGCAGGCCTCATCTCCTGGGGGG + Intergenic
1175681925 20:60995349-60995371 TCCTGGCCTCTTGTGCTGTGGGG + Intergenic
1175834914 20:61987301-61987323 CCTTGGTCTCCTCTGCTTGGTGG - Intronic
1175964556 20:62654061-62654083 TCCTGGCCTCCGGAGCTGGTGGG - Intronic
1175969556 20:62677560-62677582 TCCTGCCATCCTCTGCTCAGTGG - Intronic
1176797463 21:13380508-13380530 TCCTGGTCTCCCCATCTGGGAGG + Intergenic
1179780212 21:43694747-43694769 TCCTGGGGCCCTCTGCTGGGAGG - Exonic
1179890073 21:44330905-44330927 TCCTGGGCGCCGCTGCTGAGAGG + Exonic
1180083482 21:45497260-45497282 TCCTGGACGGCTGTGCTGGGAGG - Intronic
1180951911 22:19724269-19724291 TCCCGGCCCGCTCTGCTGGGGGG + Exonic
1181033177 22:20157882-20157904 TCCCGCCCTCCCCTGCTGTGGGG - Intergenic
1181169505 22:21000312-21000334 TGCCGGCCTCCCCAGCTGGGAGG - Exonic
1181584385 22:23845116-23845138 TCCTGGCCTACCCAGCTTGGGGG + Intergenic
1181676121 22:24454610-24454632 TCCTGCCCTCTTCTGCTTGGAGG + Intergenic
1182070661 22:27461526-27461548 TCCTGGCCACCTTGCCTGGGTGG + Intergenic
1182088877 22:27580533-27580555 TCCTGGCCACTTCTGCTAAGTGG + Intergenic
1183107595 22:35625954-35625976 TCCCAGCCTCCTCTGCAGTGAGG - Intronic
1183363551 22:37395539-37395561 TCCCAGCCTCCTCTGCTGTCAGG + Intronic
1183728141 22:39600770-39600792 TCCTGGACCCCTGGGCTGGGAGG + Intronic
1183987644 22:41578249-41578271 TCCTGGCCTCCTCCGTTGCTGGG - Intronic
1184053071 22:42023307-42023329 TCCTAGCCTACTCTGGTTGGGGG - Intronic
1184075394 22:42174030-42174052 TCCTGCGCTTCTCTGCTGGTGGG + Intronic
1184143644 22:42595301-42595323 TCCTGTGCGACTCTGCTGGGAGG + Intronic
1184169440 22:42750511-42750533 GCCCGGCCGCCCCTGCTGGGAGG - Intergenic
1184436923 22:44484812-44484834 ACCTGGCCTCCTCTCCTGGCTGG + Intergenic
1184452771 22:44592681-44592703 TGCTGACCTGCTCTGCTGGGCGG - Intergenic
1185092588 22:48784372-48784394 TCCTGGCCTCCTTTGGGGCGTGG + Intronic
1185354903 22:50362388-50362410 GCTGGGCCTCCGCTGCTGGGAGG + Intronic
1185401887 22:50623242-50623264 TGTTGGCCTCCTCTGCAGGGAGG - Intronic
949506855 3:4736745-4736767 TTCTGGGCTCCTGTGTTGGGAGG + Intronic
950211063 3:11123942-11123964 TCCTGGCCTCTCCTTCTGTGAGG + Intergenic
950345248 3:12287639-12287661 TCCTCGCCACCACCGCTGGGAGG - Intronic
950416888 3:12873931-12873953 CCCAGGCCTGCTCTACTGGGTGG - Intergenic
950612839 3:14137244-14137266 TCATGGCCTTCTAGGCTGGGAGG - Intronic
950667390 3:14505731-14505753 GCCAGGCCTCCGCTCCTGGGGGG + Exonic
950879541 3:16311997-16312019 GCCTGGCTTCCTCTGCTGGAGGG + Intronic
953611512 3:44451028-44451050 TCCAGGAGTCCTCTACTGGGGGG - Intronic
953983440 3:47424285-47424307 TCCAGCCCTCCTGTGCTGGATGG - Intronic
954117429 3:48474905-48474927 GCCTGGCCTCTTCTGCATGGTGG - Intronic
954127428 3:48539666-48539688 TCCTTGGCTCCTCTCCTTGGCGG - Intronic
954425446 3:50440657-50440679 GCCTGGCCTGGTCTCCTGGGTGG + Intronic
954753275 3:52825636-52825658 TCTTTGCCTCTGCTGCTGGGAGG - Intronic
954906509 3:54067737-54067759 TCCTGGCCCCCTCTGCCCAGAGG + Intergenic
955388368 3:58498622-58498644 GTTTGGCCTCCTCTGTTGGGTGG + Exonic
958406069 3:93760606-93760628 GCCTGGCCTCCCCATCTGGGAGG - Intergenic
960848154 3:122023508-122023530 TCATGCCCTGCTCTGCTGTGAGG + Intergenic
960949528 3:122990209-122990231 TCATTCCCTCCTCTGCTGAGGGG + Intronic
961393221 3:126569028-126569050 TCCTGGCCTCATCTCCATGGAGG + Intergenic
961673621 3:128551688-128551710 TCCTGTTCCCCTGTGCTGGGAGG - Intergenic
962764525 3:138549267-138549289 TGCTGGCTTTCTCAGCTGGGAGG + Intronic
963804940 3:149713944-149713966 TGCTGGCCACCACTGCGGGGAGG + Intronic
963825299 3:149946445-149946467 TCCTGGCCTTTTTTGTTGGGAGG + Intronic
965885706 3:173444675-173444697 TCCTGGCCTCAACGGCTGGATGG + Intronic
966874694 3:184315233-184315255 TCCTGGCCTACACTCCTGGGCGG + Intronic
967252052 3:187550177-187550199 TCCTTGCCTTTTCTGCTAGGTGG + Intergenic
967878767 3:194284427-194284449 TCCAGGCCCCCTCTACTGAGAGG - Intergenic
968381683 4:101778-101800 GCCTGGAAGCCTCTGCTGGGAGG + Intergenic
968543306 4:1179286-1179308 ACCTGGCCTCCTTTGCAAGGTGG - Intronic
968689667 4:1984069-1984091 CGCTGGGCTCCTCTGGTGGGCGG + Exonic
968713211 4:2135894-2135916 TGCAGGCATCCTCTACTGGGAGG + Intronic
969423537 4:7110837-7110859 TGCTGACCTCCTCTGCAGAGTGG + Intergenic
969517667 4:7656620-7656642 CCCTTGCCCACTCTGCTGGGTGG + Intronic
969595581 4:8147760-8147782 TGCTGGCCTCCAGAGCTGGGAGG + Intronic
972342782 4:38166992-38167014 TCCTTGCCTCCTCCGTTGAGTGG + Intergenic
972666248 4:41167882-41167904 CTCTGGCCTCCTCTGCTAGCTGG - Intronic
975139053 4:70902158-70902180 TTCTGGTCTCCTCTGCTGCTAGG - Intergenic
975326045 4:73059929-73059951 TCCTTGCCTCTTCTGCAGTGAGG + Intronic
979304057 4:119121803-119121825 ACCTGGCCTACTCAGCTAGGGGG - Intergenic
981006502 4:139880404-139880426 TCCAGGCCTTCCCTGCTGAGGGG - Intronic
982305687 4:153928359-153928381 TCTTTGGCTCTTCTGCTGGGGGG + Intergenic
985727990 5:1525615-1525637 TCCTGGCCTGTGCTTCTGGGAGG - Intergenic
985820394 5:2156157-2156179 ACGTGGCCTCCTCCTCTGGGTGG + Intergenic
986180143 5:5385454-5385476 GCTTGGTTTCCTCTGCTGGGGGG - Intergenic
986775777 5:11012582-11012604 CTCTGGCCACCTCTGCTGAGGGG - Intronic
988486132 5:31669487-31669509 TCCTGGCCTCATCTCCCGTGTGG + Intronic
989378982 5:40795601-40795623 TGCTGGCCTTCCCTGCTGGAAGG + Intronic
989966564 5:50472146-50472168 TCCTGGCATCTTATGCTTGGTGG - Intergenic
990709485 5:58564666-58564688 GCCTGGCCTCCCCGTCTGGGAGG - Intergenic
992549364 5:77846598-77846620 TCCAGGCCTCCCTGGCTGGGAGG - Intronic
992644999 5:78803627-78803649 TGCTGGTCTCCTCGGCTGGAGGG + Intronic
993920979 5:93801741-93801763 GCATGGCCTGCTGTGCTGGGTGG - Intronic
996519312 5:124409382-124409404 TCCAGGCCTGGTCTTCTGGGAGG - Intergenic
996560326 5:124821250-124821272 TCCTGACCTCCTCTAGTGGATGG - Intergenic
997257356 5:132439266-132439288 TGCAGTCCTCTTCTGCTGGGAGG - Intronic
997365099 5:133320649-133320671 TCCAGCCCTCGTCTGCTGTGCGG + Intronic
997443880 5:133927329-133927351 TCCTGGGCTCTTGTGCTGGCTGG - Intergenic
997463370 5:134071013-134071035 CCCTAGGTTCCTCTGCTGGGCGG - Intergenic
997696625 5:135866212-135866234 TCCCAGCCTCCTCTGCTGTGTGG - Intronic
998046733 5:138993078-138993100 TCTCGGCCTCCTTTGCAGGGAGG + Intronic
1002045861 5:176541589-176541611 CCCAGGCCTCCTCTGCAGTGGGG + Intergenic
1002315289 5:178339410-178339432 TCCTGCCCTGCTCTGCTCTGAGG - Intronic
1003369215 6:5508564-5508586 TGCTTTCCTCCACTGCTGGGAGG - Intronic
1003498757 6:6687082-6687104 TCCAGGCCTCATCTCCTGGCTGG + Intergenic
1003498779 6:6687155-6687177 TCCAGGCCTCATCTCCTGGCTGG + Intergenic
1005269477 6:24148006-24148028 TCCTTGCCTCGTGGGCTGGGAGG - Intronic
1005959341 6:30684791-30684813 TCCCAGCGTCCTCTGGTGGGAGG + Exonic
1006136611 6:31899903-31899925 TCCTGGCCTCCACGCCTGCGCGG + Exonic
1006231830 6:32594742-32594764 GCCCGGCCGCCCCTGCTGGGAGG - Intergenic
1006667737 6:35708708-35708730 TCCCAGCCTCCTTTGCTGGTAGG + Intronic
1007721314 6:43887056-43887078 TCCTCACCTCCATTGCTGGGAGG - Intergenic
1009963502 6:70553155-70553177 GGCTGGTCTCCTCTGCTGGGGGG - Intronic
1010806786 6:80246522-80246544 TCCAGACCTCCTTTGGTGGGAGG + Intronic
1010817581 6:80376440-80376462 TGCTTGCTTTCTCTGCTGGGAGG - Intergenic
1011219280 6:85036856-85036878 TCCCTGCTTCCTCTTCTGGGAGG - Intergenic
1011411165 6:87067915-87067937 TGCTGAGCTTCTCTGCTGGGAGG - Intergenic
1012433696 6:99192602-99192624 TGCTGCCCTGCTTTGCTGGGAGG - Intergenic
1012889714 6:104884529-104884551 TCCTGGCCTCCTATGCAGGTAGG - Intergenic
1015701270 6:136038314-136038336 TCCTGCCTAGCTCTGCTGGGTGG - Intronic
1018181336 6:161226128-161226150 TACTGGCTACCTCTGCTGGGAGG - Intronic
1019149399 6:169994122-169994144 CCCTGCCCTTCACTGCTGGGTGG + Intergenic
1019398740 7:838367-838389 ACTTGGCCTCCTCTCCTGCGTGG + Intronic
1019511428 7:1419553-1419575 GCCTGTTCCCCTCTGCTGGGAGG + Intergenic
1019953232 7:4390335-4390357 GCCCGGCCGCCTCTACTGGGAGG - Intergenic
1022468671 7:30668296-30668318 TCCGGGCCTTCTCAGGTGGGAGG - Intronic
1022503004 7:30894276-30894298 TGCTGGCCTCCTCTTTTGTGAGG + Intergenic
1024282790 7:47733319-47733341 TCCTGCCCTCCTCTGCAGCCTGG + Intronic
1027877653 7:83791291-83791313 TTCTGGCCTGCACTGCGGGGAGG - Intergenic
1029222115 7:98998831-98998853 TCTTGGCCTCATCTGCTTGCAGG + Intronic
1029986476 7:104927598-104927620 TCCTGGCCTCCTCTTCTACCAGG - Intergenic
1030094484 7:105885799-105885821 TCCAGGTCTCCTTTGGTGGGAGG + Intronic
1031986936 7:128169300-128169322 TCCAGGCCTCCTCCGGTGGAAGG + Intergenic
1032332666 7:130994503-130994525 TCCTGGCCTCCAGAACTGGGAGG + Intergenic
1032616821 7:133481881-133481903 GCCTAGCCTCTTCTCCTGGGAGG - Intronic
1032676590 7:134135298-134135320 TTCTGGTCTCCTCCCCTGGGTGG + Intronic
1032804205 7:135339374-135339396 TCCCAGCCTCCCCTGCAGGGTGG + Intergenic
1033142501 7:138840188-138840210 TACTGGCTGCCTCTGCTTGGCGG + Exonic
1033472793 7:141664730-141664752 GCCTGGCCTCTTCTACTGCGGGG + Intronic
1033563320 7:142554886-142554908 TACCAGGCTCCTCTGCTGGGTGG + Intergenic
1033904300 7:146183182-146183204 GCCTGGCATCCTCTGGTGGGAGG - Intronic
1035553609 8:546677-546699 GCCTGGCCTCCTGGGCTAGGGGG + Intergenic
1036739327 8:11347204-11347226 TCTTGGCCTCCCCAGCTGGGAGG - Intergenic
1037800744 8:22033915-22033937 CCCTGGCCTCCACTGTTGGGAGG + Intronic
1037934782 8:22908255-22908277 TCCCAGCTTCTTCTGCTGGGTGG - Intronic
1038517143 8:28196974-28196996 TTCTGGCTTCCTCTCCTGCGTGG - Intergenic
1038628429 8:29217171-29217193 TGCAGGCCTCCTCTACAGGGTGG - Intronic
1040736629 8:50516007-50516029 TTCTGTCGACCTCTGCTGGGAGG - Intronic
1041157964 8:55007252-55007274 TCCTGGCCTCCAGAGCTGGGAGG - Intergenic
1045366918 8:101484971-101484993 TCCTGGCTTACTAAGCTGGGTGG + Intergenic
1048272617 8:133041539-133041561 TCCTCGCCTCATATCCTGGGAGG - Intronic
1049003421 8:139840217-139840239 CCCTGGCCTCCCCTGCAGGGAGG + Intronic
1049156597 8:141070968-141070990 TCCTGGCCTCCGCGTCAGGGAGG - Intergenic
1049266808 8:141671935-141671957 TCCTGCCTCCCTCTCCTGGGAGG + Intergenic
1049423206 8:142525901-142525923 TCCTGGCCTCCTCTGCTGGGGGG - Intronic
1049478727 8:142809996-142810018 CCCTGGCTTCCTCTGCCTGGGGG + Intergenic
1049693069 8:143971234-143971256 TCCTGGCCTCCTCCCCTCTGTGG - Intronic
1049745502 8:144261559-144261581 TCCTGACAGCCTCTGCTGGGAGG - Intronic
1049755027 8:144307351-144307373 TCCTGGCAGCCGCTGCGGGGTGG - Intronic
1049770211 8:144376592-144376614 TCCTGGCCTCACCTGTTTGGTGG + Intronic
1049818952 8:144622509-144622531 ACTGGGCCTCCTCTCCTGGGAGG - Intergenic
1051515947 9:17930485-17930507 TCCCAGCCTCCCTTGCTGGGAGG - Intergenic
1052985598 9:34484926-34484948 TCCTGGCCACCTCTGCCCTGGGG - Intronic
1053140716 9:35680992-35681014 TCTCGGCTACCTCTGCTGGGCGG - Exonic
1053458453 9:38250127-38250149 TCCTGGTTTCCTCTCCTGGTAGG + Intergenic
1056145883 9:83728814-83728836 GCCCGGCCGCCTCTACTGGGAGG + Intergenic
1056802430 9:89701786-89701808 TACTGGCCTCCACTGCCTGGGGG - Intergenic
1057491446 9:95523036-95523058 TCCTGGCATCCAGTGCTGAGAGG + Intergenic
1057787233 9:98096245-98096267 TCCTGGCCTCCTAGGCTGAATGG - Intronic
1057873578 9:98736056-98736078 TCCTGGCCTCCTCTGCATCCAGG + Exonic
1058049666 9:100393061-100393083 GCCTGGCCTCCCCGTCTGGGAGG + Intergenic
1058735104 9:107886886-107886908 TGCTGGCCCCCTGGGCTGGGTGG - Intergenic
1059167430 9:112091997-112092019 CGCTGGCCTCCTCTGCTGGAAGG - Intronic
1060776413 9:126378011-126378033 TCCTGTCCTCCTCTGCAAAGTGG - Intronic
1061388013 9:130301756-130301778 TGCTGGGCTCCTCTGCTGGCGGG + Intronic
1061920799 9:133781325-133781347 TCCTTGCCTCCTCTGGTGGTAGG - Intronic
1062032106 9:134366386-134366408 TCCCAGCTTCCTCTGCAGGGCGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062436752 9:136549793-136549815 ACCTGGTCCCCTGTGCTGGGCGG + Intergenic
1062566365 9:137165653-137165675 TCCTGGACTCCTCAGCTGCCGGG + Intronic
1189286288 X:39854501-39854523 GCCTGGCCCCCTCTGGTGGGAGG + Intergenic
1192658968 X:73022139-73022161 GCCTGGCCTCCCCGTCTGGGAGG - Intergenic
1192664121 X:73069695-73069717 GCCTGGCCTCCCCATCTGGGAGG + Intergenic
1192691260 X:73367089-73367111 TTCTTGCTTCCTCAGCTGGGAGG - Intergenic
1193802928 X:85958494-85958516 TCCGGGCCTCCTCCTCTGTGTGG + Intronic
1194496588 X:94623790-94623812 TCCTGGCCTGCTGTCCTTGGTGG - Intergenic
1195906374 X:109848551-109848573 CTCTGGTCTCCGCTGCTGGGTGG + Intergenic
1197727099 X:129783577-129783599 TCTTGGTCTCCTCTGCTTCGAGG + Intronic
1197734953 X:129843648-129843670 TCCTGGGCTCGGCTGCAGGGTGG - Intronic
1199991882 X:152992037-152992059 TCCTGCCCTCTTCTGCCTGGAGG - Exonic
1202028763 Y:20551741-20551763 GCCTGGCCGCCCCTTCTGGGAGG + Intergenic