ID: 1049423416

View in Genome Browser
Species Human (GRCh38)
Location 8:142526710-142526732
Sequence CTGCAGTCTCAGATTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 193}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049423416_1049423433 26 Left 1049423416 8:142526710-142526732 CCATGCCCAATCTGAGACTGCAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1049423433 8:142526759-142526781 AACGGAGGCACTGAGTACAGAGG 0: 1
1: 0
2: 0
3: 9
4: 145
1049423416_1049423428 8 Left 1049423416 8:142526710-142526732 CCATGCCCAATCTGAGACTGCAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1049423428 8:142526741-142526763 ACCCCGGAGCGGGTGGGAAACGG 0: 1
1: 0
2: 0
3: 10
4: 108
1049423416_1049423424 -2 Left 1049423416 8:142526710-142526732 CCATGCCCAATCTGAGACTGCAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1049423424 8:142526731-142526753 AGGTCCAGGGACCCCGGAGCGGG 0: 1
1: 0
2: 0
3: 24
4: 227
1049423416_1049423427 2 Left 1049423416 8:142526710-142526732 CCATGCCCAATCTGAGACTGCAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1049423427 8:142526735-142526757 CCAGGGACCCCGGAGCGGGTGGG 0: 1
1: 1
2: 0
3: 15
4: 196
1049423416_1049423425 1 Left 1049423416 8:142526710-142526732 CCATGCCCAATCTGAGACTGCAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1049423425 8:142526734-142526756 TCCAGGGACCCCGGAGCGGGTGG 0: 1
1: 0
2: 1
3: 25
4: 186
1049423416_1049423432 11 Left 1049423416 8:142526710-142526732 CCATGCCCAATCTGAGACTGCAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1049423432 8:142526744-142526766 CCGGAGCGGGTGGGAAACGGAGG 0: 1
1: 0
2: 0
3: 11
4: 146
1049423416_1049423422 -8 Left 1049423416 8:142526710-142526732 CCATGCCCAATCTGAGACTGCAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1049423422 8:142526725-142526747 GACTGCAGGTCCAGGGACCCCGG 0: 1
1: 0
2: 2
3: 28
4: 286
1049423416_1049423423 -3 Left 1049423416 8:142526710-142526732 CCATGCCCAATCTGAGACTGCAG 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1049423423 8:142526730-142526752 CAGGTCCAGGGACCCCGGAGCGG 0: 1
1: 0
2: 0
3: 21
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049423416 Original CRISPR CTGCAGTCTCAGATTGGGCA TGG (reversed) Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900773873 1:4567087-4567109 CGGCAGTGTCAGGTAGGGCATGG + Intergenic
900947477 1:5839234-5839256 CTCCAGCCTCTGATTGGCCATGG + Intergenic
901746326 1:11376117-11376139 CTGGAGGCTCAGATTGGCAAAGG + Intergenic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
901887713 1:12234981-12235003 ATGCAGTCCCTGATTTGGCATGG + Intronic
903734725 1:25522860-25522882 CTGGAGGCTCAGAGAGGGCAAGG - Intergenic
905416130 1:37805686-37805708 CTGCACTCTGAGAATGGGAAGGG + Intronic
905733121 1:40310041-40310063 CTACAGCCACAGAGTGGGCATGG - Intronic
906659750 1:47573878-47573900 ATGGAGTCTCAGAGAGGGCAAGG + Intergenic
910386305 1:86686794-86686816 CTTCAGTCTGAACTTGGGCAAGG - Intergenic
910806522 1:91194001-91194023 CTGCAGTGGCAGATTGAGCTGGG - Intergenic
911276195 1:95862057-95862079 CTGGAGTCTCAGTGTGGACAAGG - Intergenic
913220240 1:116654323-116654345 CTGCAGTCTCAGAGGGCTCACGG + Intronic
918773899 1:188603422-188603444 CTGCAGTCTCACATAGTGAAAGG + Intergenic
919283712 1:195526000-195526022 CTGCTGCCTGAGATTGGGGAAGG - Intergenic
922728929 1:227940118-227940140 CTGCAGACACAGACAGGGCAGGG - Intronic
1063331487 10:5164179-5164201 CTTCAGTCTCTGATTGGTCCTGG + Intergenic
1064933014 10:20648786-20648808 CTTCAGCCTCTGATTGGCCATGG - Intergenic
1065352321 10:24806663-24806685 CTGCAGTCTCAGGGTGTCCATGG + Intergenic
1065895683 10:30161362-30161384 CTTCAGCCTCTGATTGGTCATGG - Intergenic
1067162840 10:43842063-43842085 TTACAGTCTCACATTAGGCAGGG - Intergenic
1067717281 10:48699226-48699248 CTGCTGTCTCAGAGTGGCTATGG - Intronic
1067826793 10:49580218-49580240 CTGGAGTCTCTGAAAGGGCAGGG + Intergenic
1068740310 10:60461737-60461759 CTGCAAACTCGGATTGGGCAAGG + Intronic
1069916787 10:71791396-71791418 CTGGAGCCTCAGGTTGGACACGG + Intronic
1073144373 10:101270843-101270865 CAGCAGTCTCAGGCTGGACAAGG - Intergenic
1074563057 10:114551495-114551517 CTTCAGCCTCTGATTGGCCATGG - Intronic
1076329556 10:129654487-129654509 ATGCAGGCTCAGAGTGAGCAGGG - Intronic
1076504750 10:130964258-130964280 CTGCAGAGTGAGACTGGGCAAGG + Intergenic
1080381190 11:31773887-31773909 CTTCAGTCTTAGGTGGGGCATGG + Intronic
1082943380 11:58732405-58732427 CTGCAGCTTCAAAATGGGCATGG - Intergenic
1084202657 11:67571630-67571652 CTTCAGCCTCTGATTGGTCACGG + Intergenic
1085039257 11:73317381-73317403 AAGCAGGCTCAGAGTGGGCAGGG + Intronic
1085658258 11:78337358-78337380 CTGTAGTCTCAGAAATGGCAGGG + Intronic
1090239722 11:125173633-125173655 CTTCAGTCTCAGGTGGGGCTGGG + Intronic
1091221220 11:133931081-133931103 CTGCAGGCTCCCACTGGGCAGGG + Exonic
1093710235 12:22321423-22321445 CTGCTGCTTCAGTTTGGGCAGGG - Intronic
1093828080 12:23719687-23719709 TTGCAGCCTCAAACTGGGCAGGG - Intronic
1096148551 12:49295090-49295112 CTGCGGTCTCAGGGGGGGCACGG - Exonic
1099541817 12:83919616-83919638 CTGCAGTATCAGATTGATGATGG + Intergenic
1100185327 12:92132720-92132742 CTGTAATCTCAGATTTGGTAAGG + Intronic
1100331055 12:93582543-93582565 CTGCAGGCTCAGATTTGCCCTGG + Intronic
1101834538 12:108286291-108286313 CTGCAGCCTCAGATGAGCCATGG - Intergenic
1102762078 12:115396583-115396605 CTGCAGTCCCATATGGGCCATGG - Intergenic
1103121666 12:118385397-118385419 CAGCAGTATCAGGCTGGGCATGG - Intronic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1105505300 13:21004736-21004758 TTGCAGTCTCACATTGGGCTTGG - Intronic
1105899268 13:24742044-24742066 CTGGAGTCTCAGGATGGCCATGG - Intergenic
1106763203 13:32887957-32887979 CTTCAGCCTCTGATTGGTCACGG - Intergenic
1107716040 13:43200308-43200330 GTGCAGACTCAGAGTGGCCAAGG + Intergenic
1112828388 13:103418781-103418803 CTGGAGTCTGAGACTGGACATGG - Intergenic
1114222557 14:20709893-20709915 CTGCTGTGTCAGGTTGGGGAGGG + Intergenic
1114249878 14:20949984-20950006 CTTCTATCTCAGATTGGGAAGGG + Intergenic
1115472619 14:33783793-33783815 CTGCAGATTCTGATTGGGGAAGG - Intronic
1115523740 14:34258759-34258781 CTGCAGTGTCGGGATGGGCATGG - Intronic
1116332901 14:43617250-43617272 CTTCAGCCTCTGATTGGTCATGG + Intergenic
1117086539 14:52207401-52207423 CTGCAGTGTGATTTTGGGCATGG - Intergenic
1119261711 14:73241633-73241655 CTGCAGACTCACAGAGGGCAGGG - Intronic
1121028114 14:90631694-90631716 GTGCAGACTCAGGCTGGGCAGGG - Intronic
1121893411 14:97621031-97621053 CTTCTGACTCAGATGGGGCAAGG + Intergenic
1122879514 14:104683847-104683869 CTGCAGACTCAGAAGAGGCAGGG - Intergenic
1126097911 15:45102195-45102217 CTGCTTTCTCTGATTGGTCAAGG - Intronic
1127353261 15:58173504-58173526 CTGCTGTCTCTGATTTGGCTGGG + Intronic
1127395133 15:58538310-58538332 CTGCAATATAAGATTGGGGACGG - Intronic
1127422105 15:58816486-58816508 CTGCAGCCTCAGATGGCTCAAGG + Intronic
1127904760 15:63368407-63368429 CTGCAGTCTTAGAAGGAGCAGGG - Intronic
1133081518 16:3324707-3324729 CTGCAGTCCCAGATTTGGGGAGG - Intergenic
1133161217 16:3913035-3913057 CTGCAGTTTCAGCTGGGGCTGGG - Intergenic
1137723451 16:50641346-50641368 CTGGAGGCTTAGAGTGGGCAGGG - Intergenic
1137964881 16:52920791-52920813 CTGAAGTCACGAATTGGGCATGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1141064185 16:80900703-80900725 CTGTAGTCTCCGAGTGGCCACGG + Intergenic
1141161318 16:81630855-81630877 CTGCAGTCTTGGAGTGGGCTGGG - Intronic
1142281563 16:89150835-89150857 CTGCAGTCTCAGCCTGAGCCGGG - Intronic
1143187764 17:5020790-5020812 CTGCAGCCTGGGATTGGACAGGG - Exonic
1144823534 17:18092006-18092028 CTGCCCTCTGAGACTGGGCAGGG + Intronic
1145976233 17:28985966-28985988 CTGCATTCTCCGAGTGGGCTGGG + Intronic
1148668868 17:49395231-49395253 CTTCAGTCTCAGACTGAGCCAGG - Intronic
1148868331 17:50640928-50640950 CTGAAGTCCCAGATAGGGAAGGG - Intronic
1149971483 17:61222732-61222754 CTGGAGTCGCAGAGTGGCCATGG - Intronic
1151236606 17:72724641-72724663 CTGAAGTCTCAGAGTGGAAAAGG - Intronic
1151836592 17:76586147-76586169 CGCCAGTCTCGGGTTGGGCAGGG + Intronic
1152246726 17:79188350-79188372 CTGCAGTCTCTGCTGGGGCCAGG - Intronic
1152256535 17:79243276-79243298 CTGGAGTGTCAGAGTGAGCAGGG + Intronic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1156022563 18:32616736-32616758 GTGCAGTTTCAGATTAGGGATGG + Intergenic
1156403991 18:36767085-36767107 CTGCATTCTCAGAATGGTCACGG - Intronic
1156490916 18:37495523-37495545 CTGGAGCCTCAGATGGGGCATGG - Intronic
1158062834 18:53366821-53366843 CTGCATTCTGTGAGTGGGCAAGG - Intronic
1159035411 18:63272824-63272846 CTGCTGTCTCAGATAGAGAAGGG - Intronic
1160111313 18:76034450-76034472 CTGAAGTCTCAGATGGGGTGGGG - Intergenic
1160586113 18:79914573-79914595 CTCCAGACGCAGCTTGGGCAAGG - Intronic
1161391268 19:4022036-4022058 CTGCAGGTCCAGATTGGGCATGG - Intronic
1162353938 19:10169118-10169140 ATGCAGCCTCAGGCTGGGCATGG - Intronic
1163239510 19:16051630-16051652 CTTCAGCCTCTGATTGGTCATGG + Intergenic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1163458795 19:17424215-17424237 CTTCAGTCTTAGAATGGGGAGGG + Intronic
1163662904 19:18589183-18589205 CTGCAGAGTCAGATGGGGCGGGG + Intronic
1164388175 19:27794426-27794448 CTACAGTCTCAGCATGCGCAGGG + Intergenic
1166898033 19:46036288-46036310 CTGCAGCCACAACTTGGGCAGGG - Intergenic
926169382 2:10542157-10542179 CTGCATTCTCAGAGTCGGCTAGG - Intergenic
927185010 2:20475759-20475781 CTGCAGCCTCAGATGGGCCGTGG + Intergenic
927827781 2:26321378-26321400 AGGCAGTCTCAGATGGGCCAAGG + Intronic
930539442 2:52686754-52686776 CTGGAGTCTCAGAATGGGGGAGG + Intergenic
930862426 2:56088748-56088770 GTGAAGTTTCAAATTGGGCAGGG + Intergenic
931093275 2:58910597-58910619 CTGAAGTCTCAGATTTCACAGGG - Intergenic
937256808 2:120561425-120561447 CAGCACTGTCAGAATGGGCAAGG - Intergenic
939749575 2:146026548-146026570 CTGCTGTCTCAGGTGCGGCAGGG - Intergenic
939858172 2:147386036-147386058 TTACAGTTTCAGGTTGGGCATGG + Intergenic
941287353 2:163630637-163630659 CTGCATTCCCAGATTTAGCAAGG + Intronic
942016947 2:171827398-171827420 CTTCAGCCTCTGATTGGTCATGG + Intronic
942128910 2:172857803-172857825 CTGCAGTCTCAGACTCTCCAGGG - Intronic
946644464 2:221818190-221818212 GTGCAGGCTCTGATAGGGCACGG - Intergenic
947932935 2:233978942-233978964 CTACAGTCTCAGATGTGGAAGGG - Intronic
948371566 2:237492885-237492907 CTGCAGGCTCTGTGTGGGCAGGG - Intronic
1170502765 20:16991599-16991621 CTGAAGTCACAGATTGACCATGG + Intergenic
1170573276 20:17644579-17644601 CTGTAGTTACAGACTGGGCAGGG + Intronic
1170652764 20:18257675-18257697 CTGCAGGGTAAGGTTGGGCAGGG + Intergenic
1171041587 20:21769125-21769147 CTGTTGTCTAACATTGGGCAGGG + Intergenic
1173897804 20:46563920-46563942 CTGCACTCTCACATTGGAGAAGG - Intronic
1174157526 20:48525564-48525586 CTTCAGCCTCTGATTGGTCATGG + Intergenic
1174557244 20:51404691-51404713 CTGCATTTTCAGAATGGGCAGGG + Intronic
1174818484 20:53707044-53707066 CTGCAGTCTAAAATTAGACATGG - Intergenic
1176121239 20:63455512-63455534 ATGCAGTCACAGACTGAGCATGG + Intronic
1176220787 20:63968588-63968610 GTGCAGTGCCAGATTGGGCCAGG - Intronic
1178526601 21:33334910-33334932 CTGCAGTGGGAGATGGGGCAGGG + Intronic
1179478879 21:41665419-41665441 CTGCAGGCTCAGACAGGGCTGGG + Intergenic
1180821540 22:18832342-18832364 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
1181191438 22:21143703-21143725 CTGCAGTCTCAGAGGGCTCACGG - Intergenic
1181207760 22:21266807-21266829 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
1181574256 22:23783737-23783759 CGACTGTCTCAGACTGGGCAGGG + Exonic
1181918319 22:26298750-26298772 CTGCTGTCTCTGTTTAGGCAGGG + Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183353668 22:37347332-37347354 CTGCAGCTTCAGATTTGGAAAGG - Intergenic
1184952110 22:47850827-47850849 CTCCAGTCTCAGAGTGGGACAGG + Intergenic
1203219160 22_KI270731v1_random:28609-28631 CTGCAGTCTCAGAGGGCTCACGG - Intergenic
1203271665 22_KI270734v1_random:58218-58240 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
949632566 3:5944312-5944334 CAGCAGTCTGAGATTGACCAGGG - Intergenic
962369542 3:134809737-134809759 CTGCATGCTCAGATAAGGCAGGG - Intronic
962825413 3:139096207-139096229 CTGCAGTCTCAGACTGTCCAGGG - Intronic
963316736 3:143766862-143766884 TTGCAGTCTAAGGCTGGGCATGG - Intronic
964102230 3:153001101-153001123 CTGGAGTGTCAGTTTGGCCAAGG - Intergenic
970024737 4:11611312-11611334 CTGCAGACTCAGATTAGGTAAGG - Intergenic
970309599 4:14768262-14768284 TAGCAGAGTCAGATTGGGCAGGG + Intergenic
975869922 4:78768699-78768721 CTACATTCTCTGATTGGCCAAGG + Intergenic
978577719 4:110202798-110202820 CTTCAGGCTGAGAGTGGGCAGGG + Intergenic
981484960 4:145276290-145276312 CTCCAGTCTCAGAGTGGGGTGGG - Intergenic
984293265 4:177822239-177822261 CTCCAGCCTCAGATGGGGCTTGG + Intronic
986976054 5:13395441-13395463 CAGCAGACTCAGATTTGGCCTGG + Intergenic
992860168 5:80901294-80901316 CTTCAGCCTCTGATTGGTCATGG - Intergenic
993526283 5:88969724-88969746 ATGCAGTCACAGTTTTGGCAAGG + Intergenic
995956639 5:117784493-117784515 GTGGAGTCTCAGAGTGGGCTTGG + Intergenic
996339406 5:122419279-122419301 GTGCAGTCTTAGAATGTGCAAGG - Intronic
999154808 5:149450601-149450623 CTGCAATCCCAGATTGGGCCAGG + Intergenic
1000965876 5:167655999-167656021 CTGCAGTTTCATATTGCGCCGGG + Intronic
1002065730 5:176650804-176650826 GTGCAGTCTCAGAGGGGGAAAGG - Intronic
1003386849 6:5676302-5676324 CTACATTCTCAGATTAGGCATGG + Intronic
1005810400 6:29510969-29510991 CTGCACACTCAGATTGTGCAGGG - Intergenic
1006413233 6:33887890-33887912 CTGCAATCTTATATTTGGCATGG - Intergenic
1008084398 6:47229040-47229062 ATGCAGCCTCAGGCTGGGCATGG + Intergenic
1017456039 6:154602329-154602351 TTGCAAACTCAGATTGGTCATGG - Intergenic
1017882215 6:158569859-158569881 CTGCAATCCCAGAAAGGGCATGG - Intronic
1018703484 6:166446387-166446409 CTGTAGTCTCAGAAGGGACAAGG + Intronic
1022910077 7:34892298-34892320 CAGCAGTGTCAGTTGGGGCATGG - Intergenic
1025145582 7:56499148-56499170 TTGCAGTCTCACATTTGGGATGG - Intergenic
1027683740 7:81254842-81254864 TTGAAGGCTCACATTGGGCAAGG + Intergenic
1029692740 7:102193048-102193070 CTGCAGCCCCAGGTTGGGGAAGG - Intronic
1029815649 7:103091833-103091855 CTGCTGTCTGACATTGGGCAGGG + Intronic
1030701890 7:112648910-112648932 CCAGAGTCTCTGATTGGGCAGGG - Intergenic
1032071585 7:128811047-128811069 CTGAGGTCTCAGCGTGGGCAAGG + Intronic
1032248468 7:130232726-130232748 CTGCAGTCTATGCTTGGTCAAGG - Intergenic
1034041507 7:147882202-147882224 CTGCTGTCTAACATGGGGCATGG - Intronic
1034283290 7:149868242-149868264 CTCCACTCTCAGGCTGGGCAGGG + Intergenic
1035201452 7:157269895-157269917 CTGCAGGCTCACGATGGGCAGGG - Intergenic
1037882960 8:22581756-22581778 GTGCAGTCACAGGCTGGGCAGGG + Intronic
1038501988 8:28052606-28052628 CTGCAGTTTCAGAGGGAGCATGG + Intronic
1038591933 8:28847178-28847200 CTTCAGTCTTAGATAGGGCCAGG - Intronic
1038681826 8:29675765-29675787 CTCCAGTCTCATCTTGGGCTGGG - Intergenic
1043259685 8:78180759-78180781 CTTCAGCCTCTGATTGGTCATGG - Intergenic
1043519508 8:81028932-81028954 AGGCAGTTTCAGATTGGCCAGGG - Intronic
1043785379 8:84391765-84391787 CTGAAGTCTCAGAATGAGCTAGG - Intronic
1049000974 8:139825492-139825514 CTGAGGTCTGAGGTTGGGCATGG - Intronic
1049363387 8:142224956-142224978 CTGCAGGCTCAGGTGGGGAAGGG - Intronic
1049423416 8:142526710-142526732 CTGCAGTCTCAGATTGGGCATGG - Intronic
1051508238 9:17848384-17848406 CTGAATTCTCAGATTGTGGAAGG - Intergenic
1054919499 9:70527855-70527877 CTGCAGCCTCACATGGGGGAAGG - Intergenic
1056913859 9:90728330-90728352 CTGCAGTCTCAGCTGGGACCTGG - Intergenic
1059232573 9:112735139-112735161 CAGAAGTCTAAGATTGTGCAAGG + Intergenic
1061493888 9:130960910-130960932 CTGCAGTCTCAGGTTCTGCGGGG - Intergenic
1061670362 9:132185056-132185078 CTGCAGGCTGAGAATGGGCTGGG + Intronic
1062391646 9:136336282-136336304 CTGCAGTGTCAGCATGGGCTGGG - Intronic
1185789035 X:2914528-2914550 CTGCATTTTCAGGTGGGGCAAGG - Intronic
1186199906 X:7147211-7147233 ATGCAGATTCTGATTGGGCAGGG + Intronic
1186537822 X:10368139-10368161 ATGCAGTCTCAGGCTGGGCGCGG + Intergenic
1188711855 X:33410789-33410811 CTGGAGTCTAAGACTTGGCAAGG - Intergenic
1189203149 X:39215138-39215160 CTGCAGTGGCAAATTGGACACGG - Intergenic
1190333726 X:49250516-49250538 CTGCAGTCTAAGCTGAGGCATGG + Exonic
1192265650 X:69535834-69535856 TTGCAGCCTCAGCATGGGCAAGG + Intergenic
1193885267 X:86976489-86976511 ATGTGGTCTCAGAATGGGCATGG - Intergenic
1194762737 X:97813804-97813826 CTGTTATCTCAGAATGGGCACGG + Intergenic
1195907601 X:109861052-109861074 CTGAAGGCTCAGCTTGGGGAAGG - Intergenic
1198740893 X:139841635-139841657 CTGTAGTCTCAGCATGGGGATGG - Intronic
1199427071 X:147715009-147715031 CTTCAGTCTCAGATAGGGTGAGG + Intergenic
1199865216 X:151841198-151841220 TTACAGTCTCAGAATGGGGAAGG + Intergenic
1200021749 X:153217605-153217627 CTTCAGGCTCAGTTTGAGCACGG + Intergenic
1200835252 Y:7726099-7726121 CTGCAGTGTCAGATCTGGGAGGG + Intergenic