ID: 1049426470

View in Genome Browser
Species Human (GRCh38)
Location 8:142540134-142540156
Sequence CTAAATGACCAGAGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049426470_1049426476 25 Left 1049426470 8:142540134-142540156 CCATGCTCCCTCTGGTCATTTAG 0: 1
1: 0
2: 1
3: 21
4: 198
Right 1049426476 8:142540182-142540204 GACAGCCCTGGCAGAGGAGCTGG No data
1049426470_1049426475 19 Left 1049426470 8:142540134-142540156 CCATGCTCCCTCTGGTCATTTAG 0: 1
1: 0
2: 1
3: 21
4: 198
Right 1049426475 8:142540176-142540198 TCTAGAGACAGCCCTGGCAGAGG No data
1049426470_1049426477 26 Left 1049426470 8:142540134-142540156 CCATGCTCCCTCTGGTCATTTAG 0: 1
1: 0
2: 1
3: 21
4: 198
Right 1049426477 8:142540183-142540205 ACAGCCCTGGCAGAGGAGCTGGG No data
1049426470_1049426473 13 Left 1049426470 8:142540134-142540156 CCATGCTCCCTCTGGTCATTTAG 0: 1
1: 0
2: 1
3: 21
4: 198
Right 1049426473 8:142540170-142540192 ACCTTCTCTAGAGACAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049426470 Original CRISPR CTAAATGACCAGAGGGAGCA TGG (reversed) Intronic
904033272 1:27546291-27546313 CAAAATGATCAAAGGGAACAAGG - Intronic
904383640 1:30127737-30127759 CTAAAGAATCAGAAGGAGCATGG - Intergenic
906431366 1:45758350-45758372 CTAAATTTCCTGAGGGAACAAGG - Intergenic
906613578 1:47219967-47219989 CTCAATGACCAGGAGGAGGAGGG - Exonic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
909345760 1:74584509-74584531 CAGAAAGACCACAGGGAGCAGGG - Intronic
909465419 1:75968528-75968550 CTAAATGACCAGGGAGCTCATGG - Intergenic
911484712 1:98490901-98490923 TTAAAATACAAGAGGGAGCAAGG + Intergenic
912540108 1:110408141-110408163 CTAAAGGACGAGATGGAGCAAGG + Intergenic
916455736 1:164969574-164969596 CCAAGTGACCACATGGAGCACGG - Intergenic
918132499 1:181642033-181642055 CAAAATAATAAGAGGGAGCAGGG + Intronic
919486565 1:198155134-198155156 CTAAATCAGAAGAGGGAGTAGGG - Intergenic
920123638 1:203676666-203676688 CCAGATCACCAGGGGGAGCAAGG + Intronic
920819579 1:209367898-209367920 CTAGATGACCAGATGGAGAATGG + Intergenic
921199544 1:212792001-212792023 ATACGGGACCAGAGGGAGCAGGG + Intronic
923206755 1:231766561-231766583 CTAAATGAGCAGAGGAAGGGTGG + Intronic
1063214266 10:3909830-3909852 CTAACTGGGCAGAGGAAGCAAGG + Intergenic
1063517317 10:6709693-6709715 CAAAATGAGAAGAGAGAGCAGGG + Intergenic
1064263327 10:13803921-13803943 GCAAATGACCGGAGGGAGCTGGG - Intronic
1064293725 10:14058653-14058675 TTACATGACCAGAGGGAGGTTGG + Intronic
1065001406 10:21340860-21340882 CTAGATGACAGTAGGGAGCAAGG + Intergenic
1068299384 10:55118993-55119015 CCCATTGAACAGAGGGAGCATGG - Intronic
1068587681 10:58817508-58817530 GTAAATGCCCAGAGAGAACATGG - Intronic
1069699237 10:70409022-70409044 CTAAATGATCAGACTGAGCAGGG + Intronic
1070430895 10:76336562-76336584 CTAAATGACAAGAGGGGGTGGGG + Intronic
1071437671 10:85662345-85662367 CAAAAGGACCAGAGGGTGCTTGG + Intronic
1072064552 10:91853266-91853288 CTACAGGACCAGAGGTGGCATGG - Intronic
1077456369 11:2683709-2683731 CTAGGTAACCAGAGGGAGTAAGG - Intronic
1080208576 11:29758269-29758291 CTGACTGTTCAGAGGGAGCATGG - Intergenic
1084461027 11:69296677-69296699 GAAAATGACCAGAAGGAGCTGGG - Exonic
1084721902 11:70911760-70911782 CAAAATGACAAGAGTGAGAATGG + Intronic
1086096022 11:83050590-83050612 CTAAATGAGCAGTGGTACCAAGG + Intronic
1087417016 11:97870293-97870315 CTAAAGGACAATAGGGAGGAAGG - Intergenic
1088318433 11:108530748-108530770 CTAAAGGGCCAGAGGGTGCCTGG + Intronic
1088361734 11:108997972-108997994 CTAAATGACCAGTGGGTCAATGG - Intergenic
1090071322 11:123546934-123546956 CAGAATGACCAGTAGGAGCAGGG + Intronic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1092145270 12:6210381-6210403 CTATATGACCAGTGGAACCAAGG + Intronic
1092754854 12:11753665-11753687 CTGAATTACCAGAGAGAGAAAGG - Intronic
1094090680 12:26645592-26645614 TTGAATGCCCAGAGGCAGCATGG + Intronic
1094462723 12:30714859-30714881 GCAAATGACAAAAGGGAGCAAGG + Intronic
1095747412 12:45675193-45675215 CTAAAGGAGCAGGGTGAGCAGGG + Intergenic
1097241897 12:57581342-57581364 CTAAATGACCTCAGGGACCAGGG + Intronic
1097514871 12:60592802-60592824 CTAAATGAAATGTGGGAGCAAGG + Intergenic
1099033141 12:77554002-77554024 CAAGATGGCCAGAGAGAGCAGGG - Intergenic
1099060822 12:77905972-77905994 AGAAGTGACCAGAGGGAGCAAGG - Intronic
1099595020 12:84650743-84650765 CAACATAAGCAGAGGGAGCAGGG - Intergenic
1101851062 12:108402646-108402668 ATATATGACAAGAGGGATCAGGG + Intergenic
1102026378 12:109716035-109716057 CTTAAACACCAGAAGGAGCAGGG - Intronic
1102371091 12:112382571-112382593 CTGAATGGCCAGGGGGAGAAGGG - Intergenic
1102426172 12:112846043-112846065 CCTAGTGACCAGGGGGAGCAAGG + Intronic
1106826924 13:33533037-33533059 CTAAGTGGCCAGTGGGAGAAAGG + Intergenic
1107566543 13:41611042-41611064 CTAAATGAGCAGAGGCACCAGGG - Intronic
1110146590 13:72199177-72199199 CCAGATGACCAGAGGGAGGGGGG + Intergenic
1113334835 13:109367781-109367803 CTAAATGCACACAGGGAGAATGG + Intergenic
1114358620 14:21943739-21943761 CTAAAAGATCAGAGGTAGCCAGG - Intergenic
1117320331 14:54616175-54616197 GTGCATGAGCAGAGGGAGCAAGG - Intronic
1119624582 14:76161593-76161615 CAAAATTGCCAGGGGGAGCAGGG - Intronic
1119745459 14:77040644-77040666 CTCACTGACTAGAGGGAGGAGGG - Intergenic
1121275954 14:92667787-92667809 CTGAATGACCATATGGAGCATGG - Intronic
1121998709 14:98628032-98628054 CTAAAGTCTCAGAGGGAGCATGG + Intergenic
1122082982 14:99279817-99279839 CTTAGGGATCAGAGGGAGCATGG - Intergenic
1202896149 14_GL000194v1_random:11652-11674 CTAAATGGCCAGAGGCATCTGGG + Intergenic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1128855814 15:71013619-71013641 CTAACTGACGAGGTGGAGCATGG + Intronic
1130219857 15:82010337-82010359 TTAGATGACCAGAGGGTCCATGG - Intergenic
1131592404 15:93763871-93763893 CTACAAGACCAGAGAGGGCATGG - Intergenic
1131681518 15:94728833-94728855 CGAAATGGCCCGAGAGAGCAAGG - Intergenic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1133323191 16:4927305-4927327 CTCAAAGACAAGAGGGAGCGAGG + Intronic
1133892907 16:9898295-9898317 CTAAATGGCAAGGGGAAGCATGG - Intronic
1134857995 16:17536784-17536806 CTGAATGAGAAGAGGGAGCCAGG + Intergenic
1135044061 16:19140261-19140283 CGAAATGACCAGAGGGCCCCAGG + Intronic
1136040359 16:27574000-27574022 TGAAAGGACCTGAGGGAGCAGGG + Intronic
1137726523 16:50660391-50660413 CTAAAACATCAGAGGGAGCATGG + Intergenic
1138275968 16:55734996-55735018 CTAAATGACCAAAGTGTTCAAGG + Intergenic
1138477105 16:57277972-57277994 CTAAATGAGCAGAGGCTGCCGGG + Intronic
1140166790 16:72560869-72560891 CTAAATGACCAAATAGAGCCTGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140574946 16:76156796-76156818 CTCAAGGACCAAAGGGAGCCAGG - Intergenic
1140668272 16:77248066-77248088 CTAAAGTCCAAGAGGGAGCAAGG + Intronic
1140953249 16:79839178-79839200 CTCAGTGTCCAAAGGGAGCAGGG - Intergenic
1140963198 16:79937394-79937416 GTAAATGACCCCAGGGAGAACGG - Intergenic
1140990548 16:80207033-80207055 CTAAATAACAAGAGGGAACAAGG - Intergenic
1141709007 16:85687335-85687357 ATAACGGAACAGAGGGAGCACGG + Intronic
1145916454 17:28576876-28576898 CTCATTTACCAGAGGGAGCCAGG - Exonic
1146095087 17:29922157-29922179 CCTAAAGACCAAAGGGAGCATGG + Intronic
1146487837 17:33258502-33258524 CTAAATGAAGTGAGGGAGCGAGG + Intronic
1146634595 17:34494677-34494699 CCAGGTGACCAGAAGGAGCAGGG + Intergenic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147772428 17:42877249-42877271 CTACAAGACCTGAGGCAGCAGGG - Intergenic
1148856927 17:50583996-50584018 CTTAGTGTCCAGAGGGAGGAAGG + Intronic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1150202288 17:63369998-63370020 TTAAATGAGAAGAGAGAGCAGGG - Intronic
1151060813 17:71091596-71091618 TTAAATGGCAAGACGGAGCAAGG - Intergenic
1151353782 17:73546554-73546576 CTGGCTGACCAGAGGGAGCAAGG + Intronic
1151418484 17:73982292-73982314 CTCAAGGAGAAGAGGGAGCAAGG + Intergenic
1152157043 17:78641311-78641333 CTGGTTGACCAGAGGGAGCTTGG - Intergenic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1153180920 18:2432209-2432231 TTAAAAGACCAGAGGGAGGGAGG - Intergenic
1156290874 18:35747837-35747859 ATAAATGAGGGGAGGGAGCAGGG + Intergenic
1156912667 18:42429035-42429057 CTAGATCACCAGGGGGAGGAAGG + Intergenic
1157268848 18:46253683-46253705 CCAAATGACCTGAGAGAGAAGGG - Exonic
1157785044 18:50474178-50474200 CAAAATGACCAGTGGGTGGATGG + Intergenic
1158652924 18:59303782-59303804 CTACATGTCTACAGGGAGCATGG - Intronic
1159860001 18:73636673-73636695 CTAACTGACCACAGTGAGCCTGG + Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1161588467 19:5118047-5118069 CCAAGTGTCCCGAGGGAGCATGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1166449513 19:42886233-42886255 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166460811 19:42986526-42986548 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166478106 19:43146516-43146538 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166848796 19:45747403-45747425 CTACATGATCAGACGGGGCAGGG - Intronic
927689217 2:25195827-25195849 CTTAATGAGGCGAGGGAGCAAGG - Intergenic
930892866 2:56411491-56411513 ATAAATGCCTAGAGGGAGCAGGG + Intergenic
931441966 2:62296447-62296469 GTAAATAACCAAAGGGAACATGG + Intergenic
939825693 2:147012838-147012860 CTAATTGATCACAGGGAGGAGGG - Intergenic
941858474 2:170254206-170254228 CTAAATGTCTATAGGGATCATGG - Intronic
942745520 2:179227780-179227802 GAAAATGAGCAGAGGCAGCAGGG + Intronic
943079656 2:183242966-183242988 CTGAATGACTAAAGGGAGCACGG + Intergenic
943615406 2:190086578-190086600 ATAACTGAGCAAAGGGAGCATGG - Intronic
944593037 2:201236196-201236218 CTAAATGCCTAAAAGGAGCAGGG - Intronic
945335756 2:208591155-208591177 GAAAATGACGTGAGGGAGCAAGG - Intronic
946414014 2:219530300-219530322 CTAAATCCCCAGCGGGAGCCTGG + Intronic
946456707 2:219832365-219832387 CTAAATGAGCAGACGGTGCGAGG - Intergenic
948505530 2:238424999-238425021 CTAAATGCCCACATGGTGCAGGG - Intergenic
1169061254 20:2662071-2662093 CTAAACCTTCAGAGGGAGCAGGG + Intronic
1169656380 20:7928955-7928977 CTTGATGACCCAAGGGAGCAGGG - Intronic
1172874926 20:38158408-38158430 CCAAATGACCACAGGGAGCCTGG + Intronic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175274836 20:57761209-57761231 CCAAAGGACCAGAGGGAGCTTGG - Intergenic
1175920581 20:62448880-62448902 ATAAATGAATAGAGGGTGCAGGG - Intergenic
1176187759 20:63790675-63790697 CTCAACGAGCAGAGGCAGCACGG - Exonic
1176615829 21:9027635-9027657 CTAAATGGCCAGAGGCATCTGGG + Intergenic
1181043471 22:20203786-20203808 ATAATTGATCAGAGGGAGGAGGG + Intergenic
1181331309 22:22094027-22094049 GTATATAACCAGAGGGTGCAAGG - Intergenic
1182567489 22:31211146-31211168 CCAAATGACCAGAAAGAGGATGG - Intergenic
1183306033 22:37083733-37083755 CTTAGTTACCAGAGGGAGCAAGG + Intronic
954962485 3:54578589-54578611 CTGTATCACCAGAGGGAGCCGGG - Intronic
956760349 3:72437648-72437670 CTAAATTGACAGAGGGAGAAAGG + Intronic
959130137 3:102344753-102344775 CTAAATGACAAGAAGGAGCCTGG + Intronic
959817925 3:110697881-110697903 CTGAGTTTCCAGAGGGAGCATGG - Intergenic
962699889 3:137987389-137987411 CTAAATAAACAGTGGGAGAAAGG + Intergenic
967527904 3:190514927-190514949 CTAAATACTGAGAGGGAGCAAGG + Intronic
970178860 4:13366543-13366565 CAAAATGACCAAGCGGAGCATGG + Intronic
970884401 4:20970527-20970549 CCAAATGTCCAGTGGGTGCAGGG - Intronic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
978792570 4:112678046-112678068 CTAAATGAAGTGATGGAGCAAGG - Intergenic
981550001 4:145934501-145934523 CTAACTGAACAGAAGGAGCTGGG + Intronic
983141001 4:164149108-164149130 TCACATGACAAGAGGGAGCAAGG - Intronic
987306439 5:16642089-16642111 CTAAAGGACCAGAAGATGCAGGG - Intergenic
988114855 5:26873113-26873135 CTAAATGGCTAGAGAGAGGAAGG + Intergenic
989778444 5:45236390-45236412 TGAAATGACCATAGGGAGCTAGG - Intergenic
990723451 5:58725442-58725464 ATAAATAATCAGAGGTAGCAAGG - Intronic
992146599 5:73856228-73856250 AAAAATGACTAGAGGTAGCATGG + Intronic
992332746 5:75733916-75733938 CAAAAAGACCTGAGGGAGCTTGG - Intergenic
992697253 5:79302382-79302404 CTAAAAGACTAGGAGGAGCAGGG - Intronic
993136003 5:83965384-83965406 CTAACTGAGCAGAGACAGCAGGG + Intronic
995265737 5:110157252-110157274 CTAAATGATCATAGAGATCATGG - Intergenic
995827736 5:116319615-116319637 CTTATTGTCCAGAGGAAGCAGGG - Intronic
997021455 5:130007599-130007621 CTAAATGTCCACAGGGGTCATGG - Intronic
997681115 5:135751384-135751406 CTAAGGAACCACAGGGAGCAGGG - Intergenic
997700992 5:135899334-135899356 CTAAATAACCAGATGGGGAAAGG - Intergenic
998992548 5:147833873-147833895 GGAAATGACCAGATTGAGCAAGG - Intergenic
999198517 5:149799581-149799603 CTAAATGCCCAGAGAGAGACTGG + Intronic
1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG + Intronic
1001690493 5:173629308-173629330 CTAAATAACAAGAAGGAGCTGGG + Intergenic
1003569987 6:7249453-7249475 GTAAATGACCAGAGGAAAGATGG + Exonic
1004113927 6:12749055-12749077 CTCCATGACCAGCGGGACCAGGG + Intronic
1004519217 6:16346498-16346520 CTAAATGCAAAGAGGGAGCAAGG - Intronic
1005522004 6:26609967-26609989 CTAAATGGGCAGAGAGAGGATGG + Intergenic
1005659053 6:27975431-27975453 CTAAATGACCAGAGAAAATAGGG + Intergenic
1005943394 6:30578203-30578225 GTAAATGACCTGAGGGGGAATGG + Intronic
1007943426 6:45803490-45803512 AGAAATGGCCAGAGAGAGCAGGG - Intergenic
1009655488 6:66539716-66539738 CTAAAAGCCCAGAGTAAGCAGGG - Intergenic
1009681761 6:66902675-66902697 CTGTATGACCATAGGCAGCACGG - Intergenic
1013490814 6:110644750-110644772 CTAAAACACCAGAGGAAGGAGGG - Intronic
1013491208 6:110647342-110647364 CTAAAACACCAGAGGAAGGAGGG - Intronic
1013695454 6:112697670-112697692 CTAAATTACCATATGGGGCATGG - Intergenic
1014319537 6:119909426-119909448 CTAAATTAGCAGAGGTAGAAGGG - Intergenic
1015279095 6:131413352-131413374 ATAAAGGACTAGAGGGAGCTGGG + Intergenic
1015810924 6:137161546-137161568 CTAAATGATCAGAGCAGGCATGG - Intronic
1016747922 6:147600615-147600637 CTAAATGAGGAGAGGGAGAGTGG - Intronic
1018489032 6:164272768-164272790 CTCAAGGCCCAGAGGAAGCAAGG - Intergenic
1018799432 6:167210707-167210729 CCAAGTGGGCAGAGGGAGCAGGG + Intergenic
1020757504 7:12221770-12221792 CAAAATGACTAGAGTTAGCAGGG + Intronic
1021589081 7:22241388-22241410 CTAAATAAATAGAGGGGGCAGGG + Intronic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022464884 7:30646957-30646979 CTGAATGGCCAGAGGGAGTACGG + Intergenic
1026807926 7:73439312-73439334 GAAAATGTCCAGAAGGAGCATGG + Intergenic
1031366091 7:120902009-120902031 TTAAATGACCTGATGGAGAATGG + Intergenic
1032485024 7:132279228-132279250 TCTAATGACCAGAGGGAACAAGG - Intronic
1033975544 7:147096019-147096041 CTAAATCAATAGAGAGAGCATGG - Intronic
1035079025 7:156200817-156200839 CTAGCTGAGCAGGGGGAGCAGGG + Intergenic
1035901087 8:3459254-3459276 CTCATGGACCAGAGTGAGCAGGG + Intronic
1038975906 8:32695794-32695816 TTAAAGAATCAGAGGGAGCAAGG + Intronic
1040806345 8:51401160-51401182 GAAAATGACCAGGGGTAGCAAGG + Intronic
1041487735 8:58397255-58397277 AAAAATGACCAGATAGAGCAGGG - Intergenic
1042168537 8:65970688-65970710 ACAAATGACCAGAGTGACCAAGG + Intergenic
1042423600 8:68620457-68620479 CTGTATTACCAGAGTGAGCAAGG + Intronic
1043465241 8:80499581-80499603 CTAAATGAACAGAGAAAGAAAGG + Exonic
1045206577 8:100048182-100048204 CTAAATGTCCAAATGGAGAATGG + Intronic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG + Exonic
1057745133 9:97745363-97745385 CTAAAGGACCAGATGGAGCATGG - Intergenic
1058927767 9:109684400-109684422 CTCAGTGACCACAGGGAGAAGGG + Intronic
1059444682 9:114330823-114330845 CTGAATGTCCAGCGGGAGAATGG + Exonic
1060423836 9:123488316-123488338 TTACAAGACCAGAGGGAGCATGG + Intronic
1060711135 9:125865210-125865232 CTATATGGCCAGAGGGCTCAAGG + Intronic
1186188187 X:7042097-7042119 ATAAATGAAAAGAGGGAGAAGGG - Intergenic
1187429652 X:19210547-19210569 CAAAATGACCAGAGCAAGCTTGG + Intergenic
1188050172 X:25474843-25474865 CTAGGAGACCAGAGGGTGCAGGG + Intergenic
1188072623 X:25735906-25735928 CTGAATGACAAGAAGGAGCCAGG + Intergenic
1189965293 X:46366375-46366397 CTAAATGAAAGGAGGGGGCAGGG - Intergenic
1192827205 X:74709726-74709748 CTAAATGACAAGGATGAGCAGGG + Intergenic
1200009588 X:153111134-153111156 TTAAATGACCAAAGGGAGAGTGG + Intergenic
1200030012 X:153288788-153288810 TTAAATGACCAAAGGGAGAGTGG - Intergenic
1201149223 Y:11086359-11086381 CTAAATGGCCAGAGGCATCTGGG + Intergenic