ID: 1049427976

View in Genome Browser
Species Human (GRCh38)
Location 8:142545721-142545743
Sequence CTGGAGACACAGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049427976_1049427993 18 Left 1049427976 8:142545721-142545743 CCTGCTTCCCTCTGTGTCTCCAG No data
Right 1049427993 8:142545762-142545784 CCCGAAGGGAGCCTAGTTGGGGG No data
1049427976_1049427991 17 Left 1049427976 8:142545721-142545743 CCTGCTTCCCTCTGTGTCTCCAG No data
Right 1049427991 8:142545761-142545783 CCCCGAAGGGAGCCTAGTTGGGG No data
1049427976_1049427984 3 Left 1049427976 8:142545721-142545743 CCTGCTTCCCTCTGTGTCTCCAG No data
Right 1049427984 8:142545747-142545769 GGGGCAGCCTGAACCCCCGAAGG No data
1049427976_1049427985 4 Left 1049427976 8:142545721-142545743 CCTGCTTCCCTCTGTGTCTCCAG No data
Right 1049427985 8:142545748-142545770 GGGCAGCCTGAACCCCCGAAGGG No data
1049427976_1049427987 15 Left 1049427976 8:142545721-142545743 CCTGCTTCCCTCTGTGTCTCCAG No data
Right 1049427987 8:142545759-142545781 ACCCCCGAAGGGAGCCTAGTTGG No data
1049427976_1049427989 16 Left 1049427976 8:142545721-142545743 CCTGCTTCCCTCTGTGTCTCCAG No data
Right 1049427989 8:142545760-142545782 CCCCCGAAGGGAGCCTAGTTGGG No data
1049427976_1049427996 29 Left 1049427976 8:142545721-142545743 CCTGCTTCCCTCTGTGTCTCCAG No data
Right 1049427996 8:142545773-142545795 CCTAGTTGGGGGAAGCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049427976 Original CRISPR CTGGAGACACAGAGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr