ID: 1049431690

View in Genome Browser
Species Human (GRCh38)
Location 8:142568292-142568314
Sequence GACGGCCTTGTGAGGACTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049431680_1049431690 17 Left 1049431680 8:142568252-142568274 CCTTCTAAGAGGAAGAGAGTAGG No data
Right 1049431690 8:142568292-142568314 GACGGCCTTGTGAGGACTCGGGG No data
1049431679_1049431690 25 Left 1049431679 8:142568244-142568266 CCTGGTGTCCTTCTAAGAGGAAG No data
Right 1049431690 8:142568292-142568314 GACGGCCTTGTGAGGACTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049431690 Original CRISPR GACGGCCTTGTGAGGACTCG GGG Intergenic
No off target data available for this crispr