ID: 1049432675

View in Genome Browser
Species Human (GRCh38)
Location 8:142572477-142572499
Sequence TCAGCCTTGTGAGCTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049432675_1049432678 -1 Left 1049432675 8:142572477-142572499 CCACCACCAGCTCACAAGGCTGA No data
Right 1049432678 8:142572499-142572521 ACCCCCAACACCCTTTCTGCAGG No data
1049432675_1049432680 0 Left 1049432675 8:142572477-142572499 CCACCACCAGCTCACAAGGCTGA No data
Right 1049432680 8:142572500-142572522 CCCCCAACACCCTTTCTGCAGGG No data
1049432675_1049432684 4 Left 1049432675 8:142572477-142572499 CCACCACCAGCTCACAAGGCTGA No data
Right 1049432684 8:142572504-142572526 CAACACCCTTTCTGCAGGGTTGG No data
1049432675_1049432685 5 Left 1049432675 8:142572477-142572499 CCACCACCAGCTCACAAGGCTGA No data
Right 1049432685 8:142572505-142572527 AACACCCTTTCTGCAGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049432675 Original CRISPR TCAGCCTTGTGAGCTGGTGG TGG (reversed) Intergenic
No off target data available for this crispr