ID: 1049434520

View in Genome Browser
Species Human (GRCh38)
Location 8:142580190-142580212
Sequence TGGGCTGGCCACAGGGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049434520_1049434528 -1 Left 1049434520 8:142580190-142580212 CCCCTTGCCCTGTGGCCAGCCCA No data
Right 1049434528 8:142580212-142580234 AGCCCACTCCCACCACTGCCAGG No data
1049434520_1049434532 7 Left 1049434520 8:142580190-142580212 CCCCTTGCCCTGTGGCCAGCCCA No data
Right 1049434532 8:142580220-142580242 CCCACCACTGCCAGGCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049434520 Original CRISPR TGGGCTGGCCACAGGGCAAG GGG (reversed) Intergenic
No off target data available for this crispr