ID: 1049438068

View in Genome Browser
Species Human (GRCh38)
Location 8:142596830-142596852
Sequence GTCCTGGCCACCCACTGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049438068_1049438073 12 Left 1049438068 8:142596830-142596852 CCTTGACAGTGGGTGGCCAGGAC No data
Right 1049438073 8:142596865-142596887 TCTGGTCTGCCCAAGCTCTTTGG No data
1049438068_1049438070 -6 Left 1049438068 8:142596830-142596852 CCTTGACAGTGGGTGGCCAGGAC No data
Right 1049438070 8:142596847-142596869 CAGGACGCTAATGCCCTCTCTGG No data
1049438068_1049438076 30 Left 1049438068 8:142596830-142596852 CCTTGACAGTGGGTGGCCAGGAC No data
Right 1049438076 8:142596883-142596905 TTTGGCCCTTCAACTCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049438068 Original CRISPR GTCCTGGCCACCCACTGTCA AGG (reversed) Intergenic
No off target data available for this crispr