ID: 1049438637

View in Genome Browser
Species Human (GRCh38)
Location 8:142599151-142599173
Sequence CCTGGCATGGGGAGGCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049438620_1049438637 11 Left 1049438620 8:142599117-142599139 CCGACCACCCCGTTTCACTGTGG No data
Right 1049438637 8:142599151-142599173 CCTGGCATGGGGAGGCTGTGTGG No data
1049438624_1049438637 7 Left 1049438624 8:142599121-142599143 CCACCCCGTTTCACTGTGGGGAG No data
Right 1049438637 8:142599151-142599173 CCTGGCATGGGGAGGCTGTGTGG No data
1049438626_1049438637 4 Left 1049438626 8:142599124-142599146 CCCCGTTTCACTGTGGGGAGGCG No data
Right 1049438637 8:142599151-142599173 CCTGGCATGGGGAGGCTGTGTGG No data
1049438627_1049438637 3 Left 1049438627 8:142599125-142599147 CCCGTTTCACTGTGGGGAGGCGG No data
Right 1049438637 8:142599151-142599173 CCTGGCATGGGGAGGCTGTGTGG No data
1049438629_1049438637 2 Left 1049438629 8:142599126-142599148 CCGTTTCACTGTGGGGAGGCGGA No data
Right 1049438637 8:142599151-142599173 CCTGGCATGGGGAGGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049438637 Original CRISPR CCTGGCATGGGGAGGCTGTG TGG Intergenic
No off target data available for this crispr