ID: 1049439265

View in Genome Browser
Species Human (GRCh38)
Location 8:142601788-142601810
Sequence TCCCTGGGGGCCCAGGTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049439265_1049439281 22 Left 1049439265 8:142601788-142601810 CCCGGGACCTGGGCCCCCAGGGA No data
Right 1049439281 8:142601833-142601855 CTCAACAGCTGTGCACGAGAGGG No data
1049439265_1049439275 -6 Left 1049439265 8:142601788-142601810 CCCGGGACCTGGGCCCCCAGGGA No data
Right 1049439275 8:142601805-142601827 CAGGGAGGGGCAGCCTGCTGCGG No data
1049439265_1049439280 21 Left 1049439265 8:142601788-142601810 CCCGGGACCTGGGCCCCCAGGGA No data
Right 1049439280 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049439265 Original CRISPR TCCCTGGGGGCCCAGGTCCC GGG (reversed) Intergenic
No off target data available for this crispr