ID: 1049439266

View in Genome Browser
Species Human (GRCh38)
Location 8:142601789-142601811
Sequence CTCCCTGGGGGCCCAGGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049439266_1049439281 21 Left 1049439266 8:142601789-142601811 CCGGGACCTGGGCCCCCAGGGAG No data
Right 1049439281 8:142601833-142601855 CTCAACAGCTGTGCACGAGAGGG No data
1049439266_1049439275 -7 Left 1049439266 8:142601789-142601811 CCGGGACCTGGGCCCCCAGGGAG No data
Right 1049439275 8:142601805-142601827 CAGGGAGGGGCAGCCTGCTGCGG No data
1049439266_1049439280 20 Left 1049439266 8:142601789-142601811 CCGGGACCTGGGCCCCCAGGGAG No data
Right 1049439280 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049439266 Original CRISPR CTCCCTGGGGGCCCAGGTCC CGG (reversed) Intergenic
No off target data available for this crispr