ID: 1049439270

View in Genome Browser
Species Human (GRCh38)
Location 8:142601795-142601817
Sequence CTGCCCCTCCCTGGGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049439270_1049439282 26 Left 1049439270 8:142601795-142601817 CCTGGGCCCCCAGGGAGGGGCAG No data
Right 1049439282 8:142601844-142601866 TGCACGAGAGGGACGCTGCCAGG No data
1049439270_1049439283 27 Left 1049439270 8:142601795-142601817 CCTGGGCCCCCAGGGAGGGGCAG No data
Right 1049439283 8:142601845-142601867 GCACGAGAGGGACGCTGCCAGGG No data
1049439270_1049439284 30 Left 1049439270 8:142601795-142601817 CCTGGGCCCCCAGGGAGGGGCAG No data
Right 1049439284 8:142601848-142601870 CGAGAGGGACGCTGCCAGGGAGG No data
1049439270_1049439280 14 Left 1049439270 8:142601795-142601817 CCTGGGCCCCCAGGGAGGGGCAG No data
Right 1049439280 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data
1049439270_1049439281 15 Left 1049439270 8:142601795-142601817 CCTGGGCCCCCAGGGAGGGGCAG No data
Right 1049439281 8:142601833-142601855 CTCAACAGCTGTGCACGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049439270 Original CRISPR CTGCCCCTCCCTGGGGGCCC AGG (reversed) Intergenic