ID: 1049439274

View in Genome Browser
Species Human (GRCh38)
Location 8:142601804-142601826
Sequence CGCAGCAGGCTGCCCCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049439274_1049439285 22 Left 1049439274 8:142601804-142601826 CCAGGGAGGGGCAGCCTGCTGCG No data
Right 1049439285 8:142601849-142601871 GAGAGGGACGCTGCCAGGGAGGG No data
1049439274_1049439281 6 Left 1049439274 8:142601804-142601826 CCAGGGAGGGGCAGCCTGCTGCG No data
Right 1049439281 8:142601833-142601855 CTCAACAGCTGTGCACGAGAGGG No data
1049439274_1049439286 27 Left 1049439274 8:142601804-142601826 CCAGGGAGGGGCAGCCTGCTGCG No data
Right 1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG No data
1049439274_1049439284 21 Left 1049439274 8:142601804-142601826 CCAGGGAGGGGCAGCCTGCTGCG No data
Right 1049439284 8:142601848-142601870 CGAGAGGGACGCTGCCAGGGAGG No data
1049439274_1049439280 5 Left 1049439274 8:142601804-142601826 CCAGGGAGGGGCAGCCTGCTGCG No data
Right 1049439280 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data
1049439274_1049439283 18 Left 1049439274 8:142601804-142601826 CCAGGGAGGGGCAGCCTGCTGCG No data
Right 1049439283 8:142601845-142601867 GCACGAGAGGGACGCTGCCAGGG No data
1049439274_1049439282 17 Left 1049439274 8:142601804-142601826 CCAGGGAGGGGCAGCCTGCTGCG No data
Right 1049439282 8:142601844-142601866 TGCACGAGAGGGACGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049439274 Original CRISPR CGCAGCAGGCTGCCCCTCCC TGG (reversed) Intergenic