ID: 1049439277

View in Genome Browser
Species Human (GRCh38)
Location 8:142601830-142601852
Sequence TCTCGTGCACAGCTGTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049439277_1049439289 8 Left 1049439277 8:142601830-142601852 CCCCTCAACAGCTGTGCACGAGA No data
Right 1049439289 8:142601861-142601883 GCCAGGGAGGGACAGGTGTGGGG No data
1049439277_1049439283 -8 Left 1049439277 8:142601830-142601852 CCCCTCAACAGCTGTGCACGAGA No data
Right 1049439283 8:142601845-142601867 GCACGAGAGGGACGCTGCCAGGG No data
1049439277_1049439287 6 Left 1049439277 8:142601830-142601852 CCCCTCAACAGCTGTGCACGAGA No data
Right 1049439287 8:142601859-142601881 CTGCCAGGGAGGGACAGGTGTGG No data
1049439277_1049439285 -4 Left 1049439277 8:142601830-142601852 CCCCTCAACAGCTGTGCACGAGA No data
Right 1049439285 8:142601849-142601871 GAGAGGGACGCTGCCAGGGAGGG No data
1049439277_1049439292 19 Left 1049439277 8:142601830-142601852 CCCCTCAACAGCTGTGCACGAGA No data
Right 1049439292 8:142601872-142601894 ACAGGTGTGGGGCCGACACAGGG No data
1049439277_1049439286 1 Left 1049439277 8:142601830-142601852 CCCCTCAACAGCTGTGCACGAGA No data
Right 1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG No data
1049439277_1049439282 -9 Left 1049439277 8:142601830-142601852 CCCCTCAACAGCTGTGCACGAGA No data
Right 1049439282 8:142601844-142601866 TGCACGAGAGGGACGCTGCCAGG No data
1049439277_1049439291 18 Left 1049439277 8:142601830-142601852 CCCCTCAACAGCTGTGCACGAGA No data
Right 1049439291 8:142601871-142601893 GACAGGTGTGGGGCCGACACAGG No data
1049439277_1049439288 7 Left 1049439277 8:142601830-142601852 CCCCTCAACAGCTGTGCACGAGA No data
Right 1049439288 8:142601860-142601882 TGCCAGGGAGGGACAGGTGTGGG No data
1049439277_1049439284 -5 Left 1049439277 8:142601830-142601852 CCCCTCAACAGCTGTGCACGAGA No data
Right 1049439284 8:142601848-142601870 CGAGAGGGACGCTGCCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049439277 Original CRISPR TCTCGTGCACAGCTGTTGAG GGG (reversed) Intergenic
No off target data available for this crispr