ID: 1049439280

View in Genome Browser
Species Human (GRCh38)
Location 8:142601832-142601854
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049439274_1049439280 5 Left 1049439274 8:142601804-142601826 CCAGGGAGGGGCAGCCTGCTGCG No data
Right 1049439280 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data
1049439266_1049439280 20 Left 1049439266 8:142601789-142601811 CCGGGACCTGGGCCCCCAGGGAG No data
Right 1049439280 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data
1049439272_1049439280 7 Left 1049439272 8:142601802-142601824 CCCCAGGGAGGGGCAGCCTGCTG No data
Right 1049439280 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data
1049439265_1049439280 21 Left 1049439265 8:142601788-142601810 CCCGGGACCTGGGCCCCCAGGGA No data
Right 1049439280 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data
1049439273_1049439280 6 Left 1049439273 8:142601803-142601825 CCCAGGGAGGGGCAGCCTGCTGC No data
Right 1049439280 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data
1049439270_1049439280 14 Left 1049439270 8:142601795-142601817 CCTGGGCCCCCAGGGAGGGGCAG No data
Right 1049439280 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data
1049439271_1049439280 8 Left 1049439271 8:142601801-142601823 CCCCCAGGGAGGGGCAGCCTGCT No data
Right 1049439280 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data
1049439276_1049439280 -9 Left 1049439276 8:142601818-142601840 CCTGCTGCGGCACCCCTCAACAG No data
Right 1049439280 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049439280 Original CRISPR CCTCAACAGCTGTGCACGAG AGG Intergenic